| INTRODUCTIONHuman Cytomegalovirus (HCMV) is a ubiquitousβ-herpesvirus. In immunocompetent individual HCMV infection is usually asymptomatic, but the virus is not cleared and persists in a latent state. Primary infection and reactivation of latent HCMV in pregnant women can lead to severe disease to fetus and infants, including jaundice, congenital megacolon, microcephaly, and so on.The diversity of organs and cell types infected by HCMV in vivo has led to the hypothesis that HCMV disease and tissue tropism may be related to sequence variation among strains.HCMV genome consists of 230 to 235 kbp of double stranded DNA and more than 200 predicted ORF. The doulble-stranded DNA is composed of so-called unique long (UL) and unique short (US) domains, which are flanked on one end by terminal repeated sequences (TRL and TRS) and on the other end by internal repeats (IRL and TRS). The laboratory stain of AD169 was completely sequenced in 1990 (EMBL, X17403). But 19 additional ORFs, UL133-UL151, were found in the Toledo strain and other low passaged HCMV clinical isolates. This region of the genome is frequently referred to as the UL/b region of HCMV since it is found at the boundary of the unique long region (UL) and the IRL (also referred to as the b repeats). The fact that the clinical isolates retain the ORFs suggests that the predicted gene products may be essential for viral infection in vivo.HCMV UL144 gene, one of the genes the UL/b region of the UL/b region, encodes a transmembrane glycoprotein. It is a homologue of the herpes simplex virus entry mediator (HveA or HveM), a member of the tumor necrosis factor receptor (TNFR) superfamily. Therefore, the evidence mentioned above evoked the speculation that the locus may play an important role in determining the biological behavior of wild-type HCMV strains. UL146 and UL147, encode proteins with sequence characteristics of CXC alpha chemokines, suggesting that they influence the behavior of neutrophils during infection. Considerable sequence divergence has been observed in UL146 of clinical isolates from transplant recipients.The putative protein of UL141, another one of UL/b' genes, has been confirmed to downregulate a natural killer cell-activating ligand CD155, so that it could mediate a powerful NKcell evasion function.The transcripts of HCMV UL/b' region were predicted by Cha, et al. There were two TATA motifs in the untranslational region (UTR) between UL139 and UL140. Two PolyA motifs were found in the UTR between UL141 and UL142. A potential 2.5 kb transcript including UL139, UL140 and UL141 could be present.Some transcripts of HCMV were analysed before. UL57 gene transcribed three transcripts. The 5'UTR were separated by as much as 840 nt. This species may arise from bypassing of the previously described polyadenylation sites at different nucleotides, in favor of the termination signal at 73283, downstream of UL51. Previous investigations into the basis for the scarcity of the human cytomegalovirus (HCMV) gpUL4 protein (gp48) at early times in infection revealed that its expression is controlled by an unusual translational mechanism. The second of three short upstream open reading frames (uORFs), uORF2, within the 5' leader of the gpUL4 mRNA encodes a 22-codon peptide that mediates inhibition of downstream translation. The sequence of vIL-10A transcript reveals that the mRNA is derived from splicing of two introns from its precursor mRNA. The start site of vIL-10A gene was identica with that of UL111A, and the termination site was in UL111A OREIn this study, we analyzed the genetic polymorphism and transcripts of UL141 open reading frame. A full-length cDNA library was constructed in order to explore the transcripts structure of HCMV.METERIALS AND METHODSPatients and Samples29 HCMV isolates for UL141 gene polymorphisms analysis were recovered from the urine or abnormal colon tissue of infants aged less than 14 months with suspected HCMV congenital infection from 1988 to 1993. The clinical manifestations included jaundice (n=17), microcephaly (n=6) and congenital megacolon (n=6). All samples were collected at the permission of infants' parents. All virus isolates were propagated less than 10 times in human embryonic lung fibroblasts (HELF) in Eagle's minimum essential medium supplemented with 10% fetal bovine serum, and were kept at -70℃until use.HCMV DNA in all isolates was tested positive by Fluorescent-Quantified PCR in 2000 to make sure that the isolates used contained detectable HCMV DNA. Another 2 urine samples from HCMV congenitally infected patients were studied too, which were HCMV DNA positive by Fluorescent-Quantified PCR.The HCMV isolates for UL141 transcripts analysis and HCMV cDNA library were recovered from the urine or tissue of infants aged less than 5 months with HCMV infection from 2006 to 2007. The clinical manifestations included CMV hepatitis, polymeria, and CMV pneumonia. All virus isolates were propagated less than 6 times in human embryonic lung fibroblasts (HELF) in 1640 minimum essential medium supplemented with 10% fetal bovine serum, and were kept at -70℃until use. HCMV DNA in all isolates was tested positive by Fluorescent-Quantified PCR.PCR AmplificationVirus DNA was exposed from the infected cells by boiling the cell with lysis buffer for 15 min. Five pairs of primers were designed based on the Toledo sequence (Accession number: U33331) with the program primer premier 5.0 software. The sequences of the UL141 primers and PCR amplification conditions are listed in Table 1. The reaction mixture was prepared as follows: 3.5μ1 sample was added to a 50μl reaction mix containing 1×Buffer, 1.5mM Mgcl2, 0.2Mm dNTP for each, 150 ng forward and reverse primer respectively, and 0.5U rTaq polymerase.Purification and SequencingThe amplicons were purified for sequencing by recovering them from a 1.5% agarose gel using the PCR Fragment Recovery kit (Takara). Purified fragments were eluted in 50μl of ddH2O and sequenced directly with BigDye Terminators Cycle Sequencing Kit. Sequencing was carried out on both DNA strands. Sequencing reactions were performed with a PE Applied Biosystems Geneamp PCRSystem 2400 at 96℃for 10 sec, 50℃for 5 sec, and 60℃for 4 min for a total 35 cycles. The sequencing results were analyzed on an ABI 3700 automated sequencer.Sequence AnalysisORFs were predicted by the program DNAClub. Amino acid sequences were derived fromDNAsequence data using the translation program in the BioEdit 5.0.0 software. The ClustalW algorithm was used to align the nucleotide and predicted amino acid sequences. DNAStar 5.1 was used to obtain the identity of nucleotide and amino acid by performing pairwise alignments of sequences. Posttranslational modification motifs of protein were identified from the PROSITE database by the Genedoc software. Phylogenetic analysis was done using the neighbour-joining method on the sequence alignment with the original public versions of ClustalW in the DNAStar 5.1 software.Virus strain and cellsHuman embryonic lung fibroblasts (HELF), were maintained in 1640 supplemented with 10% FBS. HCMV strains were added to HELF cells at MOI 0.1. The infected cells were incubated until 70%-100% of the cells showed cytopathic effect (CPE). Cells were then collected for RNA preparation. Whole-cell RNA from HFLF cell infected with HCMV was isolated as described previously. Tab1. The PCR primer pairs and amplifying condition of HCMV UL1413' RACEPrimers①3' RACE Outer Primer: 5'TACCGTCGTTCCACTAGTGATTT 3'②3' RACE Inner Primer: 5'CGCGGATCCTCCACTAGTGATTTCACTATAGG 3'③UL141B 3'Outer Primer: 5'CTGTTCTGGGTGCTGTTGAG3'④UL141B 3'Inner Primer: 5TCGGCTGATGAACGGACT3'⑤UL141A 3' Outer Primer : 5'CGC GAC TGA GCG TCC GGT TT 3f⑥UL141A 3' Inner Primer:5' CGT GGT AGT GAC CAC CGT GCG A 3'⑦RT primer: 3 'RACE Adaptor PrimerReverse transcriptionRNA 1μl, 3'RACE Adaptor (5μM) 1μl, 5×M-MLV Buffer 2μl, dNTP Mixture (10mM each) 1μl, RNase Inhibitor 10U, Reverse Transcriptase M-MLV (RNaseH-)50U/μl, RNase Free dH2O 4.5μl, tatal volume 10μl。42℃, 60min, 70℃, 15min。Outer PCR Transcripts 3μl, 1×cDNA Dilution BufferⅡ7μl, UL141A 3'RACE Outer Primer or UL141B 3'Outer Primer (10μM) 2μl, 3'RACE Outer Primer (10μM) 2μl, 10×LAPCR BufferⅡ(Mg2+Free) 4μl, MgCl2 (25mM) 3μl, TaKaRa LA Taq 1.25U, dH2O28.75μl, total 50μl。94℃3 min, 94℃30 sec, 55℃30 sec, 20 or 30Cycles, 72℃1 min 72℃10min。Inner PCR1st PCR production 1μl, dNTP Mixture (2.5 mM each) 8μl, 10×LA PCR BufferⅡ(Mg2+Free) 5μl, MgCl2 (25 mM) 5μl, TaKaRa LA Taq 2.5 U, UL141A 3'RACEInner Primer or UL141B 3'Inner Primer (10μM) 0.5μ1, 3'RACE Inner Primer (10μM) 2μl, dH2O, 26.5μl, total 50μl。94℃3min, 94℃30sec, 55℃30sec, 30 Cycles, 72℃1 min, 72℃10min。5' RACEPrimesr①5'RACE Outer Primer: 5'CATGGCTACATGCTGACAGCCTA 3'②5'RACE Inner Primer: 5'CGCGGATCCACAGCCTACTGATGATCAGTCGATG3'③UL141B 5'Outer Primer: 5'GCGTGAGAATTACGAAGC 3'④UL141B 5'Inner Primer: 5'CGGTACTGGAGTCCGTTCAT3'⑤RT-primer: Random 9 mersAlkaline Phosphatase (CIAP)CIAP-treated RNATobacco Acid Pyrophosphatase (TAP)CIAP/TAP-treated RNA= 37℃1 hour.5'RACE Adaptor6μl RNase Free dH2O, Ligated RNA.Reverse transcription 10μl Ligated RNA 6μl, Random 9 mers (50 M) 0.5μl, 5×M-MLV Buffer 2μl, dNTP (10 mM each) 1μl, RNase Inhibitor 10U, Reverse Transcriptase M-MLV(RNase H-) 50U.30℃10min, 42℃1hr, 70℃15min.Outer PCR transcripts3μl, 1×cDNA Dilution BufferⅡ7μl, 10×LA PCR BufferⅡ(Mg2+ Free)4μl,MgCl (25mM) 3μl, TaKaRa LA Taq1.25 U, UL141B 5' Outer Primer (10μM) 2μl,5'RACE Outer Primer (10μM) 2μl dH2O 28.75μl, tatol 50μl.94℃3min, 94℃30sec, 55℃30sec 20 Cycles 72℃1min, 72℃10min.Inner PCROuter PCR production 1μl, 10×LA PCR BufferⅡ(Mg2+Free) 5μl, MgCl (25 mM) 5μl, dNTP Mixture (2.5 mM each) 8μl. TaKaRa LA Taq (5U/μl) 0.5μl, UL141B 5' Inner Primer10μM) 2μl,5'RACE Inner Primer (10μM) 2μ1,dH2O 26.5μl,total 50μl1.94℃3min, 94℃30sec, 55℃30sec 30 Cycles 72℃1 min 72℃10 min.cDNA library constructcDNA Synthesis by LD PCRFirst-Strand cDNA Synthesis1. Combine the following reagents in a sterile microcentrifuge tube.2. Mix contents and spin the tube briefly in a microcentrifuge. cDNA Amplification by LD PCR1. Preheat the PCR thermal cycler to 95℃. Total RNA Poly A+ RNA (μg) (μg) Number of Cycles2. Combine the following components in the reaction tube:3. Mix contents by gently flicking the tube. Centrifuge briefly to collect the contents at the bottom of the tube.4. Overlay the reaction mixture with 2 drops of mineral oil if necessary. Cap the tube and place it in a preheated (95℃) thermal cycler.5. Commence thermal cycling using one of the following programs: 95℃1 min,95℃15 sec,68℃6 min6. When the cycling is complete, analyze a 5-μl sample of the PCR product, alongside 0.1μg of 1-kb DNA size markers, on a 1.1% agarose/EtBr gel.7. Proceed to the next step, or store ds cDNA at -20℃until use.Proteinase K Digestion1. In a sterile PCR tube, pipet 50μl of amplified ds cDNA (2-3μg), making sure you pipet below the top oil layer of the PCR tube and add 2μl of proteinase K (20μg/μl). Store the remaining ds cDNA at -20℃(up to 3 months).2. Mix contents and spin the tube briefly.3. Incubate at 45℃for 20 min. Spin the tube briefly.4. Add 50μl of deionized H2 O to the tube.5. Add 100μl of phenol:chloroform:isoamyl alcohol and mix by continuous gentle inversion for 1-2 min.6. Centrifuge at 14,000 rpm for 5 min to separate the phases.7. Transfer the top (aqueous) layer to a clean 0.5 ml tube. Discard the interface and lower layers.8. Add 100μl of chloroform:isoamyl alcohol to the aqueous layer. Mix by continuous gentle inversion for 1-2 min.9. Centrifuge at 14,000 rpm for 5 min to separate the phases.10. Transfer the top (aqueous) layer to a clean 0.5 ml tube. Discard the interface and lower layers.11. Add 10μl of 3 M sodium acetate, 1.3μl of glycogen (20μg/μl) and 260μl of room-temperature 95% ethanol. Immediately centrifuge at 14,000 rpm for 20 min at room temperature. 12. Carefully remove the supernatant with a pipette. Do not disturb the pellet.13. Wash the pellet with 100μl of 80% ethanol.14. Air dry the pellet (～10 min) to evaporate off residual ethanol.15. Add 79μl of Deionized H2 0 to resuspend the pellet. SfiI Digestion1. Combine the following components in a fresh 0.5-ml tube:2. Mix well. Incubate the tube at 50℃for 2 hr.3. Add 2μl of 1% xylene cyanol dye to the tube above. Mix well. cDNA Size Fractionation1. Label sixteen 1.5 ml tubes and arrange them in a rack in order.2. When the storage buffer stops dripping out, carefully and gently (along the column inner wall) add 700μl of column buffer to the top of the column and allow it to drain out.3. When this buffer stops dripping (～15-20 min), carefully and evenly apply～100μl mixture of SfiI-digested cDNA and xylene cyanol dye to the top-center surface of the matrix. An unsmooth matrix surface does not hurt the following fractionation process.4. Before proceeding to the next step, allow the sample to be fully absorbed into the surface of the matrix5. With 100μl of column buffer, wash the tube that contained the cDNA, and gently apply this material to the surface of the matrix.6. Allow the buffer to drain out of the column until there is no liquid left above the resin. When the dripping has ceased, proceed to the next step. At this point, the dye layer should be several mm into the column.7. Place the rack containing the collection tubes (Section V.E.I) under the column, so that the first tube is directly under the column outlet. 8. Add 600μl of column buffer and immediately begin collecting single-drop fractions (approximately 35μl per tube) in tubes #1-16. Cap each tube after each fraction is collected. Recap the column after fraction no. 16 has been collected.9. Check the profile of the fractions before proceeding with the experiment. On a 1.1% agarose/EtBr gel, electrophorese 3μl of each fraction (separately) in adjacent wells, alongside 0.1μg of a 1-kb DNA size marker. Run the gel at 150 V for 10 min. Collect the first three fractions containing cDNA (in most cases, the fourth fraction containing cDNA is usable. Make sure the fourth fraction matches your desired size distribution). Pool the above fractions in a clean 1.5-ml tube.10. Add the following reagents to the tube with 3-4 pooled fractions containing the cDNA: (105-140μl, respectively) 1/10 vol. Sodium Acetate (3 M; pH 4.8).1.3μl Glycogen (20 mg/ml),2.5 vol. 95% ethanol (-20℃).11. Mix by gently rocking the tube back and forth.12. Place the tube in -20℃or a dry-ice/ethanol bath for 1 hr. (Optional: you may incubate at -20℃overnight, which may result in better recovery).13. Centrifuge the tube at 14,000 rpm for 20 min at room temperature.14. Carefully remove the supernatant with a pipette. Do not disturb the pellet.15. Briefly centrifuge the tube to bring all remaining liquid to the bottom.16. Carefully remove all liquid and allow the pellet to air dry for～10 min.17. Resuspend the pellet in 7μl of Deionized H2 O and mix gently. The SfiI-digested cDNA is now ready to be ligated to the SfiI-digested, dephosphorylated pDNR-LIB Vector provided. Proceed to SectionⅦ, or store cDNA at -20℃until the ligation step.Ligation of ds cDNA to pDNR-LIB1. Label three 0.5-ml tubes and add the indicated reagents (TableⅡ). Mix the reagents gently; avoid producing air bubbles. Spin tubes briefly to bring contents to the bottom of the tube. Store the unused cDNA at 4℃for later use. 2. Incubate at 16℃overnight.3. Add 95μl of sterile DEPC-treated ICO to each of the above mixtures. Add 1.5μl of glycogen. Mix well with a pipette tip. Add 280μl of ice-cold 95% ethanol. Mix by gently rocking the tube back and forth.4. Place the tube at -70℃or dry ice/ethanol bath for 1-2 hr.5. Spin in a microcentrifuge at 15,000 rpm for 20 min at room temperature.6. Carefully remove the ethanol layer without disturbing the pellet.7. Air dry the pellet.8. Resuspend each pellet (A, B, and C) in 5μl of sterile DEPC-treated H2O.Transformation of Recombinant Plasmids into E. coli1. Thaw electrocompetent cells on ice. Use the cells promptly after thawing to obtain maximum efficiency in electroporation.2. Add 970μl of LB broth to 14 ml polypropylene tubes labeled A, B, and C and to positive and negative control tubes.3. Add 25μl of thawed cells to each ligation reaction tube and to positive and negative controls. Mix thoroughly with a pipette tip.4. Transfer the mixture to a chilled 0.1 cm cuvette.5. Electroporate by discharging, and then immediately remove the cuvette from the chamber.6. Transfer the entire volume to the pre-labeled polypropylene tubes containing 970μl LB broth.7. Incubate with shaking (225 rpm) for 1 hr at 37℃.8. During the incubation, label three 1.5-ml polypropylene tubes A, B, and C. Also label tubes for positive and negative controls. Add 50μl of LB broth to each of these tubes.9. At the end of the 1 hr incubation, remove 1μl of each transformation mixture and add it to the appropriate tube containing 50μl of LB broth. Mix gently by swirling. Store the remaining transformation mixture at 4℃.10. Spread the 50μl aliquot on a prewarmed 90 mm LB agar plate containing 30μg/ml of chloramphenicol.11. Allow the inoculum to soak into the plate for 10 min.12. Invert the plates and incubate at 37℃overnight. The next day, examine your plates.13. Negative control plates should have no colonies, while plasmid positive control plates should have lots of colonies.Titering Plasmid LibrariesFrom Dilution A, and add it to 1 ml of LB broth in a 1.5-ml microcentrifuge tube. Mix by gentle vortexing. This is Dilution B. Add 1μl from Dilution A to 50μl of LB broth in a 1.5 ml microcentrifuge tube. Mix by gentle vortexing. Spread the entire mixture onto a prewarmed LB/Cm plate. Remove 50μl and 100μl aliquots from Dilution B and spread onto separate LB/Cm plates. Leave plates at room temperature for 15-20 min to allow the inoculum to soak into the agar. Invert the plates and incubate at 37℃(or 30℃) overnight. Count the number of colonies to determine the titer (cfu/ml). Calculate the titer according to the following formulas:·colony # Dilution A×103×103 = cfu/ml·(colony # ilution B/plating volume)×103×103×103= cfu/mlRESULTSThe sequence analysis of HCMV UL141 geneFinally 1 of 2 urine samples and 20 of 29 isolates, including 11 jaundice isolates, 5 microcephaly isolates and 4 congenital megacolon isolates were PCR amplified and sequenced successfully. The sequences have been deposited with the GenBank under accession numbers AY496547-AY496555, AY600459-AY600468,AY941104-AY941105. By comparison with UL141 of Toledo, all clinical strains contained a thymine deletion at nucleotide position 227, causing frame-shift mutation. Owing to the frame-shift mutation, the original UL141 ORF was replaced by two novel ORFs in clinical strains. One of the ORFs was named UL141A because it occupied the region of UL141 from 1nt to 315nt just for premature translatioanal termination due to the frameshift. The other ORF was named UL141B because it occupied another part of UL141 from 262nt to 1278nt, sharing the same encoded amino acid sequence with its homologous region in original UL141 ORF. The length of UL141 ORF in Toledo was 1278bp, while those of UL141A and UL141B in clinical strains were 309bp (or 315bp) and 1017bp respectively.UL141A and its predicted protein of clinical strains displayed 95.9-98.7% nucleotide identity and 70.2-74.0% amino acid identity to the homologous region in Toledo. Compared with the homologous region of Toledo, the UL141Bwas relatively conserved both in nucleotide and in predicted amino acid sequences. But none of the sequences was completely identical to those of Toledo. The identity scores were 97.6-98.5% and 98.5-99.4% respectively.Compared to the homologous region of Toledo, the post-translational modification sites in UL141B were conserved except for two, including the lost of Protein kinase C phosphorylation site at residues 7-8 in isolate 1m and the change from N-myristoylation site to Casein kinaseⅡphosphorylation site at residues 138-144 in isolate 10j.Transcripts structure of UL141 geneUL141A could not be transcribed, since attempts at mapping the 3'-end of the UL141A transcript in all of 3 isolates were unsuccessful. One 1 kbp 3'-RACE product mapped the 3'-end of the UL141B transcript downstream from a polyadenylation signal (AAAATAAAAA) near the 3'-end of UL141B in 3 isolates.5'-RACE using UL141B 5'Outer Primer and UL141B 5'Inner Primer generated four fragments. A product about 1.0 kbp from isolate CH mapped the 5'-end of the UL141 B transcript at -29nt upstreamed UL140 gene. The 5'-RACE product of isolate X and one of 5'-RACE products of isolate H mapped the 5'-end of the UL141 B transcript near the 5'-end of UL141B. Another two 5'-RACE product with 200bp and 100bp respectively were found in isolate H.The data demonstrate that four 3'-coterminal unspiced UL141B transcripts were found in the 3 HCMV isolates. One originated from the 5' untranslation region (5' UTR) of UL140 with the length of 1996 kbp. Another one originated from the 5'UTR of UL141B with the length of approximately 1300bp. Two UL141B transcripts originated from the inner of UL141B with the length of about 800 bp and 700bp respectively.Two new ORFs in UL141 region were found except the ORF of UL141B.No transcript motif was found in any of the 5' UTR of the four transcripts.Full-length cDNA library of HCMVA full-length cDNA library of HCMV was constructed with SMART cDNA library construct kit. 95% clones were translated sucessfully. 22 clones were selected for sequencing. 9 sequences were homology with the sequence of HCMV. Among them 5 sequences were the transcripts which had been identified. 4 sequences were the new transcripts which were not found before.Clone 024 were homology with UL153. The 5' end were located at the -127nt upstream of UL153 ORF. And the 3' end were located at the 21nt drownstream of UL153 ORF. The strains for the HCMV cDNA library were the second strain which has UL153 gene except for Towne strain.Clone 021 was homology with the complementary sequences of UL87.Clone 023 was homology with UL30. Clone 006 was homology with IRL4(TRL4).CONCLUSIONS1. HCMV UL141B gene was extensively prsent in HCMV clinical strains and was reletively conservative.2. UL141A could have not the potential to transcribe.3. Four transcripts of UL141B gene were found in three HCMV isolates.4. A full-length HCMV cDNA library were constructed. About 50% clones have the sequences that from HCMV cDNA. 75% sequences were full length.5. Four new transcripts were found in the HCMV cDNA library.
|
PDF Full Text Request