Study On The Antithrombotic Mechanism Of Decreasing The Expression Of PAI Gene By Transfecting Specific SiRNA

Objective:To design the specific siRNA for PAI,which were transfected into HASMC and HepG2 cells respectively,to decrease the expression of PAI.To construct the models of abdominal aorta thrombosis in rats,and to detect the occurrence rates of thrombosis,the thrombus length,plasma levels of fibrinogen and PAI activity,the bleeding time and coagulation time after administration.The study laid experimental foundation for further research of the therapy of PAI siRNA in thrombotic diseases.Materials and Methods:Method 1:Transfect PAI siRNA into HASMC to decrease the expression of PAI.1.1 Cell culture:The fetal thoracic aorta was taken out in aseptic conditions.After removing vascular adventitia and tunica intima,the tunica media left was sheared into about 1mm×1mm tissue masses,which were designed for culturing.Culture conditions:15%fetal bovine serum,DMEM,5%CO₂ and 37℃.The cells had digestive transfer culture by 0.04%EDTA and 0.05% trypsin after fusion growth.1.2 Designed and synthesized of PAI siRNA According to the gene sequence of PAI in Genbank,the whole genome scan and sequence analysis were carried out by RNAi design software of Ambion.The specific siRNA target for PAI was designed:5'-TTCGTGTTGA GGGAATTCCAG-3'.Then we designed the siRNA sequence as follows: 5'-UGAAGCACAACUCCCUUAAGGUC-3' and 5'-GAGACCUUAAGGGA GUUGUGCUU-3'.After annealing,they were used immediately or conserved at -20℃.1.3 Transfected PAI siRNA into HASMC by electroporationThree groups were divided:PS group(Experimental group,PAI siRNA was transfected);NS group(a sequence which was not homologous with human,mice and rabbits genome after transcription was transfected);CONT group(control group,not transfected).1.4 Detected the expression of PAI in HASMC1.4.1 ELISA was employed to measure the level of PAI in the cell culture fluidAfter coating,added 50μl PET buffer liquid to every pore in control group, then the standards or culture medium were added.After vibration incubation 1 hour at 25℃,added linker,then vibration incubation was given for another 1 hour.The substrate solution and stopping solution were added finally.PAI production in cell culture supernatant was measured by the microplate reader.1.4.2 RT-PCR was employed to measure the expression of PAI mRNAThe total RNA was extracted using Trizol agent,and then the RNA was reverse-transcribed into cDNA.PAI andβ-actin were respectively amplified by PCR.The PCR products were examined by electrophoresis with 1.5%agarose gel.Observed under extra-violet lamp and took photos,then detected the content of each cation band with the automatic analysis system of electrophoresis gel imaging.1.4.3 Western blot assay was adopted to examine the expression level of PAIThe total protein was extracted from the culture cells.After SDSpolyacrylamide gel electrophoresis,the total protein was transferred on the nitrocellulose transfer membrane,and then reacted with PAI antibody.After color reaction,photos were taken.1.5 Statistical treatmentExpression of PAI mRNA and proteins was quantified by the softwares of Image J,then were analysed by spss 10.0 statistical analysis software.Group t test was used for comparison.Method 2:Transfected PAI siRNA into HepG2 cells to detect the expression of PAI and VEGF.2.1 Construction of PAI siRNA eukaryotic expression vectorAccording to the gene sequence of PAI in Genbank,the whole genome scan and sequence analysis were carried out by RNAi design software of Ambion.Specific siRNA target for PAI was designed:5'-TTCGTGTTGAGG GAATTCCAG-3'.Then we designed the following oligonucleotides:Sense: 5'-GATCCGCGTGTTGAGGGAATTCCAGTTCAAGAGACTGGAATTCCC TCAACACGAATTTTTTGGAAA-3',and antisense:5'-AGCTTTTCCAAAA AATTCGTGTTGAGGGAATTCCAGTCTCTTGAACTGGAATTCCCTCAA CACGCG-3'.The oligonucleotides were synthesized and cloned into the vector pSilencer 2.0-U6,which were further identified by restriction endonuclease digestion analysis and DNA sequencing.2.2 Transfected PAI siRNA vector into HepG2 cells by electroporationThree groups were divided:PS group(experimental group,PAI siRNA vector was transfected);NS group(pSilencer 2.0-U6 Negative Control was transfected);CONT group(control group,no vector was transfected).2.3 Detected the expression of PAI in HepG2 cells2.3.1 RT-PCR was employed to measure the expression of PAI mRNAThe total RNA was extracted using Trizol agent,and then the RNA was reverse-transcribed into cDNA.PAI andβ-actin were respectively amplified by PCR.The PCR products were examined by electrophoresis with 1.5%agarose gel.Observed under extra-violet lamp and took photos,then detected the content of each cation band with the automatic analysis system of electrophoresis gel imaging.2.3.2 Western blot assay was adopted to examine the expression level of PAIThe total protein was extracted from the culture cells.After SDSpolyacrylamide gel electrophoresis,the total protein was transferred on the nitrocellulose transfer membrane,and then reacted with PAI antibody.After color reaction,photos were taken.2.4 Statistical treatmentExpression of PAI mRNA and proteins was quantified by the softwares of Image J,then analysed by spss 10.0 statistical analysis software.Group t test was used for comparison.Method 3:Study on the antithrombotic effect of PAI siRNA3.1 The establishment of the models of abdominal aorta thrombosis in ratsSD rats,male or female,weight about 250-300g for each one.The rats were divided randomly into two groups and each group for twenty.The rats were given each an intraperitoneal injection of sodium pentobarbital(40 mg·kg-1).The abdominal aorta(AA)and the right common iliac artery were separated carefully.A polyethylene catheter(0.8mm in diameter)with rough front end was inserted from the right common iliac artery to the AA rotatingly to injure the endothelium.The right common iliac artery was ligated after decannulation.The experimental group:An orthodontic wire(0.2mm in diameter)was placed along the AA parallelly,and then ligated them together(the degree of the AA stenosis was 88.5%±1.5%).There was no special treatment in the control group.The rats were sacrificed by carotid artery bloodletting after 2 hours.The occurrence rates of thrombosis and the thrombus length were detected.3.2 Study on the antithrombotic effect of PAI siRNA60 rats were selected to establish the models of abdominal aorta thrombosis.Three groups were divided:the control group(normal saline was injected),the tPA group(tPA was injected),and the experimental group(tPA and PAI siRNA were injected).Then the occurrence rates of thrombosis,the thrombus length,plasma levels of fibrinogen and PAI activity,the bleeding time and coagulation time were detected.Results:Method 1:1.1 Cultivation of HASMCTypical morphological changes were observed under light microscope. Immunohistochemical staining showed the positive reactions of actin.1.2 The effect of specific siRNA on PAI mRNA expression in HASMCThe electrophoresis band of the experimental group was significantly weaker than those of the two control groups(t=4.7,4.2 respectively,P＜0.01). There was no significant difference between the two control groups(t=1.45, P＞0.05).No significant difference existed in the expression ofβ-actin in three groups (P＞0.05).The experimental results showed that PAI siRNA was transfected into HASMC successfully,and PAI mRNA expression was restrained significantly.1.3 The effect of specific siRNA on the expression of PAI and tPA protein in HASMCThe electrophoresis band of the experimental group was significantly weaker than those of the two control groups(t=5.3,4.8 respectively,P＜0.01). There was no significant difference between the two control groups(t=1.88, P＞0.05).The tPA protein expression was significantly higher than those of the two control groups(t=5.8,5.4 respectively,P＜0.01).There was no significant difference between the two control groups(t=4.78,P＞0.05).The experimental results showed that PAI protein expression was restrained significantly,while the tPA protein expression was increased.Method 2:2.1 Identification of PAI siRNA eukaryotic expression vectorAnalysis and sequencing of the PAI siRNA expression vector were performed and the resulted sequences were identical to the oligonucleotides we designed.2.2 The effect of specific siRNA on PAI mRNA expression in HepG2 cellsThe electrophoresis band of the experimental group was significantly weaker than those of the two control groups(t=4.1,4.8 respectively,P＜0.01). There was no significant difference between the two control groups(t=1.86, P＞0.05).No significant difference existed in the expression ofβ-actin in three groups (P＞0.05).The experimental results showed that PAI siRNA was transfected into HepG2 cells successfully,and PAI mRNA expression was restrained significantly.2.3 The effect of specific siRNA on the expression of PAI and VEGF protein in HepG2 cellsThe electrophoresis band of the experimental group was significantly weaker than those of the two control groups(t=5.10,4.23 respectively,P＜0.01). There was no significant difference between the two control groups(t=1.67, P＞0.05).The VEGF protein expression was significantly lower than those of the two control groups(t=3.3,4.1 respectively,P＜0.01).There was no significant difference between the two control groups(t=4.67,P＞0.05).The experimental results showed that the expression of both PAI and VEGF protein was restrained significantly.Method 3:3.1 The establishment of the models of abdominal aorta thrombosisIn the experimental group and the control group,the occurrence rates of thrombosis were 77.78%and 57.90%respectively,and the thrombus length were 7.83±2.42mm and 5.74±2.04mm respectively.Statistical analysis showed that there was significant difference between the two groups.3.2 Study on the antithrombotic effect of PAI siRNAIn the experimental group,tPA group and control group,the occurrence rates of thrombosis were 47.37%,61.12%and 78.95%respectively;the thrombus length were 3.02±1.28,5.17±1.97 and 7.91±2.17mm respectively; the bleeding time were 10.93±4.15,8.85±3.11 and 4.35±1.80min respectively; the coagulation time were 9.35±3.50,6.64±2.42 and 2.32±1.07min respectively; the plasma levels of fibrinogen were 0.82±0.23,1.03±0.29 and 1.84±0.53g/L respectively;and the plasma levels of PAI activity were 4.25±0.33,8.50±0.52 and 12.44±0.78kAU/L respectively.The occurrence rates,the thrombus length and the plasma levels of fibrinogen and PAI activity were decreased in the experimental group and tPA group,while the bleeding time and coagulation time were increased.Statistical analysis showed the significant difference between the experimental group and the other two groups.Discussion:Deep venous thrombosis(DVT)is the most common type in thrombotic diseases.An epidemiological survey shows that the morbidity is about 0.71%-1.20%in our country.Reducing of fibrinolytic system activity may lead to over accumulation of fibrin,and then the venous thrombosis is induced.Fibrinolytic system activity is mainly regulated by the plasma activity of tPA and PAI.Investigation and data of epidemiology show that the reducing of fibrinolytic system activity is caused by the increased plasma PAI activity,not the decreased plasma tPA activity.Plasma PAI activity is vital to the activity of fibrinolytic system,and is the most important risk factor in clinical thrombotic diseases.It's important to decrease the plasma PAI activity for the treatment and prevention for thrombotic diseases.RNA interference(RNAi)is the process of sequence-specific degradation of homologous mRNA triggered by double-stranded RNA.As a technically simple and an effective genetic tool,RNAi can exert effect on the expression of gene and substitute for gene knock-out technique in some degree.Simultaneously, study on molecular mechanism of RNAi,which might be involved in the level of post-transcription,translation,genome methylation or conduction of silencing signals,is now making unceasing progress.According to the gene sequence of PAI in Genbank,we designed the siRNA sequence specific for PAI,and transfected PAI siRNA into HASMC by electroporation.The experimental results showed that the electrophoresis band of the experimental group was significantly weaker than those of the two control groups.The expression of PAI mRNA and protein in HASMC was significantly decreased.There was no significant difference between the two control groups.The experiment also indicated that the tPA protein expression was significantly higher than those of the two control groups.PAI siRNA eukaryotic expression vector was constructed successfully, and then was transfected into HepG2 cells by electroporation in order to investigate the mechanism of PAI.The experimental results showed that the electrophoresis band of the experimental group was significantly weaker than those of the two control groups.The expression of PAI mRNA and PAI protein in HepG2 cells was significantly decreased.There was no significant difference between the two control groups.The experiment also showed that the VEGF protein expression was significantly lower than those of the two control groups, which indicated the possible mechanism between PAI and VEGF.The experimental results showed that PAI siRNA were transfected into HASMC and HepG2 cells successfully,and PAI mRNA and protein expression was restrained significantly.At the same time,we obtained cells with the stable expression of PAI siRNA.The levels of tPA and PAI maintain dynamic balance normally.When the PAI expression is inhibited specifically,the tPA expression may increase.The animals experiment showed that the occurrence rates,the thrombus length and the plasma levels of fibrinogen and PAI activity were decreased in the experimental group and tPA group,while the bleeding time and coagulation time were increased.Statistical analysis showed the significant difference between the experimental group and the other two groups.The study laid experimental foundation for further research of the therapy of PAI siRNA in thrombotic diseases.Conclusion:1.The expression of PAI mRNA and protein was restrained significantly by PAI siRNA.The expression of PAI mRNA and protein in HASMC and HepG2 cells was significantly decreased in experimental group compared with the two control groups.PAI siRNA might play a specific inhibitory role in decreasing PAI mRNA and protein expression.2.The experimental results showed that PAI siRNA were transfected into HASMC and HepG2 cells successfully.At the same time,we obtained cells with the stable expression of PAI siRNA.3.The experiments showed that the tPA protein expression was significantly higher than those of the two control groups,which indicated that tPA expression might increase when the PAI expression was inhibited specifically.4.The experiments showed that the VEGF protein expression was significantly lower than those of the two control groups,which indicated the possible mechanism between PAI and VEGF.5.In the experiment of constructing thrombosis models,the occurrence rates of thrombosis was 77.78%,and the thrombus length was 7.83±2.42mm in the experimental group,which showed higher success rate compared with the control group.6.The tPA and PAI maintained dynamic balance normally.When the PAI expression was inhibited specifically,the tPA expression might increase.The occurrence rates,the thrombus length and the plasma levels of fibrinogen and PAI activity were decreased in the experimental group and tPA group,while the bleeding time and coagulation time were increased.Statistical analysis showed the significant difference between the experimental group and the other two groups.The study laid experimental foundation for further research of the therapy of PAI siRNA in thrombotic diseases.