Objective:The viral protein R(Vpr)of humam immunodeficiency virus type-1(HIV-1)is a small basic protein(14 kDa)of 96 amino acids, and is well conserved in HIV-1,HIV-2 and SIV.The role of Vpr in the pathogenesis of AIDS is undeniable,but its genetic diversity and real functions during the natural course of infection are still subject to debate. The Vpr role in the patho-physiology of AIDS has been believed very important.Experimental animals infected with some defective vpr mutants or a vpr null mutant showed decreased virus replication and delayed disease progression,displayed a very low virus burden and did not develop immunodeficiency disease.Despite its small size,Vpr has been shown to play kinds of functions during virus replication,including an effect on the accuracy of the reverse-transcription process,the nuclear import of the viral DNA as a component of the pre-integration complex (PIC),cell cycle progression,regulation of apoptosis,and the trans-activation of the HIV-LTR as well as host cell genes.Furthermore, Vpr is found in virions,in cells,and exists as free molecules found in the sera and the cerebrospinal fluid of AIDS patients,indicating that it may exert its biological functions through different manners.This study is focused on the following topics:1 genetic diversity and molecular epidemic characteristics of HIV-1 vpr gene among Chinese HIV-1 infected population;2 whether the capability of vpr induced apoptosis changed when its amino acid occurred mutation.Methods:A total of 154 DNA fragments was obtained from 348 citrated blood samples of Chinese HIV-1 infected patients.17 patients had contracted the HIV-1 infection homosexually and bi-sexually,75 heterosexually,45 drug used,blood transfusion 4,selling blood 2, unknown 11.No patients had received antiretroviral therapy.The viral RNA was extracted from plasma samples(0.5-1.0ml)using QIAamp Viral RNA was extracted from plasma samples(0.5-1.0 ml)using QIAamp Viral RNA Mini Kit.One fifth of the isolated RNA was reverse transcribed and amplified by polymerase chain reaction using a single-tube system(QiaGen One-Step RT-PCR,QiaGen,Toronto, Ontario,Canada)using primers Vpr1F(GAGACTGGC ATTTGGGTCA) and Vpr1R(TTTGTAAAGGTTGCATTACAT).The reaction conditions were 1 cycle at 50℃for 30 minutes;1 cycle at 95℃for 15 minutes;30 cycles at 95℃for 1 minute,50℃for 1 minute,72℃for 1.5 minutes;and 1 cycle at 70℃for 1.5 minutes.Three micro liters of the primary RT-PCR reaction were added to a secondary PCR mixture(QiaGen Hot-Start with primers Vpr2F[GCAGGACATAACAA GGTAGGA]and Vpr2R[GTCGCTGTCTCCGCTTC])and amplified.Reaction conditions were 1 cycle at 95℃for 15 minutes;30 cycles at 95℃for 1 minute, 50℃for 1 minute,72℃for 1.5 minutes;then lcycle at 70℃for 10 minutes.The amplied fragments were purified using a QiaQuick Gel extraction Kit(QIAGEN,S.A,France),and then directly sequenced with second-round primers by using Big-Dye Chemistry(Applied Biosystems, France)according to the instructions of manufacturer.Electrophoresis and data collection were done on an Applied Biosystems 3100 Genetic Analyzed.The raw nucleic acid sequences were aligned with known vpr representative sequence available in the Las Alamos database using Clustalw.Sites with any gap between sequences and areas of uncertain alignment were excluded from the analysis.Pairwise evolutionary distances were estimated with Kimura's two parameters methods. Phylogenetic trees were constructed by Neighbour-Jioning method3and the reliability of the tree was assessed by bootstrap analysis.One thousands bootstraps values for studied sequences replicates were evaluated for each phylogy.The criterion used to subtype the vpr sequence was clustering with available published vpr reference sequences of different subtypes in phylogenetic trees on the web of Las Alamos National Laboratory.DNAsp software was used to analyze the polymorphism of nucleotides of vpr gene.Results 1.Subtype AB can be found in bi-sexual and homosexual cases;subtype AE mainly found in male,and main transmission patterns are heterosexual and drug users.Subtype BC is similar with AE in respect of both gender and transmitted pattern.2.Subtype -specific amino acid substitutions could be identified.For example,R37N37,H41,V48,T63,Y72 were found in subtype B/AB only,R3,Q24,G41,V70,G94in subtype C/BC,G6,I70,Q86,G89,S89in subtype AE.To differentiate between subtype B/AB and C/BC,Vif aa 28 et al(R in the former,Q in the latter, expressed R/Q),aa 28 and 84 were most suitable(R/Q/N,T/L/I subtype B/AB,C/BC and AE,respectively).For subtype determination,analysis of short vpr fragment comprising the above mentioned aa might be sufficient.3.We have discovered that the amino acids mutation sites in 55,63,70,85,86,89 and 94 are likely related to the clinical manifestation of HIV-1 infected individuals.Conclusion.The epidemiological characteristics of various subtypes of HIV-1 infected Chinese patients are different.Some subtype-specific aa substitution is identified.The mutations at 55,63,70,85,86,89,94 site of HIV-1 Vpr are possibly correlated with clinical manifestation of HIV-1 infected individuals. Objective:The viral protein R(Vpr)of HIV-1 is a small basic protein (14 kDa)of 96 amino acids,and is well conserved in HIV-1,HIV-2 and SIV. The role of Vpr in the pathogenesis of AIDS is undeniable,but its genetic diversity and real functions during the natural course of infection are still subject to debate.The Vpr role in the patho-physiology of AIDS has been believed very important.Experimental animals infected with some defective vpr mutants or a vpr null mutant showed decreased virus replication and delayed disease progression,displayed a very low virus burden and did not develop immunodeficiency disease.Despite its small size,Vpr has been shown to play kinds of functions during virus replication,including an effect on the accuracy of the reverse-transcription process,the nuclear import of the viral DNA as a component of the pre-integration complex(PIC),cell cycle progression, regulation of apoptosis,and the trans-activation of the HIV-LTR as well as host cell genes.Furthermore,Vpr is found in virions,in cells,and exists as free molecules found in the sera and the cerebrospinal fluid of AIDS patients,indicating that it may exert its biological functions through different manners.This study is focused on the following topics: 1 genetic diversity and molecular epidemic characteristics of HIV-1 vpr gene among Chinese HIV-1 infected population;2 whether the capability of vpr induced apoptosis changed when its amino acid occurred mutation.Methods:We selected representative 14 mutants through statistical methods.Both eukaryotic expression vector pcDNA3.1(+)and PCR products purified,double-cut by HindⅢand BamH and the cut products legated and transformed into competent cells JM109.The 14 reconstructed plasmid was confirmed right by sequencing,and then transfected into Hela-cells by liposome transiently,established two control Hela blank and pcDNA3.1blank.Cells were harvested after 72 hours with G418 selective medium.mRNA expression was detected by RT-PCR,cell viability detected by typan blue staining methods,fluorescent microscope observed Hoeschst stained cell for death cells,percentage of apoptosis measured by flow cytometry using Anexcin-FITC-PI staining and DNA fragmentation was analyzed by agarose gel electrophoresis,we also explored the possible pathway of apoptosis.Results:Subtype AE has a weaker potential to induce apoptosis,the mutation 85P and 94G is the most important factor.Subtype B showed a strong ability to result in apoptosis.Conclusion:Subtype AE has a weaker potential to induce apoptosis, the mutation 85P and 94G is the most important factor.Subtype B showed a strong ability to result in apoptosis.The mechanism of apoptosis resulted from Vpr maybe related with activation of Caspase 3.
|