Screening Of Pathogenicity-related Genes In Bone Marrow CD4~+ T Cells Of Aplastic Anemia Patients | | Posted on:2008-04-15 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:M Zheng | Full Text:PDF | | GTID:1114360272967015 | Subject:Internal Medicine | | Abstract/Summary: | | | Partâ… The comparison study of bone marrow CD4~+T cells in aplastic anemia patients and healthy subjects on proliferation capablity, apoptosis feature and the impact of their secreted cytokines on hematopoietic stem/progenitor cellsObjective: To discuss the specific properties of marrow CD4~+T cells from aplastic anemia patients in respecting cell proliferation capablity, apoptosis features and the impact of their secreted cytokines on hematopoietic stem/ progenitor cells so as to provide a novel clue for the pathological mechanism of aplastic anemia.Methods: CD4~+T cells were isolated from the bone marrow of aplastic anemia patients and healthy subjects with immunomagnetic beads sorting. Their proliferation capabilities were examined with the improved MTT method. Their properties of apoptosis induced by high concentrational CD3 monoclonal antibody were detected. The influences of CD4~+T cell culture supernatant on cord blood-source CD34+ hematopoietic stem/progenitor cells were also observed, including the impact of cell culture supernatant on cord blood CD34+ hematopoietic stem/progenitor cell CFU-GM formation and key Cyclin D subgroup (Cyclin D3) mRNA and protein expression levels.Results: Aplastic anemia group marrow CD4 + T cells presented more enhanced reproductive activity. Evident apoptosis cells could be seen under electron microscope in both normal group and aplastic anemia group after high concentrational CD3 monoclonal antibody effecting for 18h. The apoptosis cells were more in aplastic anemia group than normal group. Apoptosis-induction quantitative detection was done with flow cytometer:the apoptosis cells in the early and advanced stage of aplastic anemia group were more than those of normal group. Apoptosis rate in early stage: normal group(7.03±0.86)%, aplastic anemia group(16.11±1.37)%; apoptosis rate in advanced stage: normal group(2.07±0.42)%, aplastic anemia group(8.05±0.36)%. The influence of marrow CD4~+ T cell culture supernatant on cord blood CD34+ hematopoietic stem/progenitor cell CFU-GM formation was CFU-GM of aplastic anemia group (74.50±9.50)/104; CFU-GM of normal group (124.25±19.80)/104, observing under an inverted microscope. A significant difference was present in the comparison between the two groups. Cord blood CD34+ cell CyclinD3 mRNA and protein expression levels were down-regulated by marrow CD4~+ T cell culture supernatant of aplastic anemia patients.Conclusion: Aplastic anemia patients marrow CD4~+T cells were likely in an abnormally proliferative,activated state which could correlate intimately with aplastic anemia hemopoiesis damage. Aplastic anemia patient marrow CD4~+T cell could secret some soluble humoral agents that could inhibit hematopoietic stem cell proliferation-dependent Cyclin D3, accordingly its proliferation was suppressed, resulting in hemopoiesis failure. Partâ…¡Establishment of a suppressive subtractive hybridization(SSH) library of aplastic anemia bone marrow CD4~+T cellsObjective: To compare the genome changes of marrow CD4~+T cells between from aplastic anemia patients and from healthy subjects in order to find some genes to regulate functions of marrow CD4~+ T cells of aplastic anemia patients.Methods: Marrow CD4~+ T cells were separated with magnetic bead sorting technique. With CD4~+ T cells of a typical first-visit aplastic anemia patient as"tester"and those of a normal donor as"driver", a cDNA library was established by suppressive subtractive hybridization.Results: The agarose gel electrophoresis clearly indicated three bands--28s, 18s and 5s, thus suggesting that total RNA of bone marrow CD4~+ T cells extracted from normal donor and aplastic anemia patient were intact. The PCR analysis indicated that the band intensities of PCR products were similar between with G3PDH 3'primer, PCR Primer l and with G3PDH 3'primer, 5'primer. The result suggested that the efficiency of adaptor ligation was rather high. 110 clones were detected by means of PCR in the established subtractive library, which contained an inserted fragment with 100~700bp respectively, and the positive detected rate was up to 88%.Conclusion: A SSH library of marrow CD4~+ T cells of aplastic anemia was successfully established. This study provided a solid foundation for the next experiment and made it easy for screening and cloning aplastic anemia-related genes of marrow CD4~+ T cells. Partâ…¢Sequence and Homology analysis of differentially expressed gene clonesObjective: To analyse the sequences of the clones from the above subtracted cDNA library and the homology of the differentially expressed genes.Methods: The 10 clones which contained different inserted fragments were picked randomly out for sequence analysis. The used sequencing primer was M13-47 (CGCCAGGGTTTTCCCAGTCACGAC). By Blast software, the obtained sequences were compared with Genebank non-redundant database.Results: These 10 differentially expressed gene clones represented 8 known genes including 2 repeatedly detected ones. They wereâ‘ transducin (beta)-like 1X-linked receptor 1 (TBL1XR1) ( NM024665 )â‘¡T cell-specific transcription factor (Tcf-1)(NM213648)â‘¢ATP-binding cassette, sub-family B (MDR/TAP),member 6(NM005689)â‘£ARP2 actin-related protein 2 homolog (ACTR 2)(NM005722)⑤zinc finger protein 561(ZNF561)(NM152289)â‘¥Interferon-inducible protein 1-8U(XR019460)⑦NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6(NM002493)â‘§eukaryotic translation initiation factor 3, subunit 5(NM003754).Conclusion: The clones of this library were selectively sequenced and analyzed by Blast. Some genes were found that they could take part in regulating the functions of marrow CD4~+ T cells from aplastic anemia patients. The recognized genes included some genes connected with protein synthesis, biology oxidation, signal transduction, proliferation regulation, cell migration and some gene whose function was unclear. Up to the present, the immune injury effects of the above genes in aplastic anemia have not been reported. Partâ…£Bioinformatics analysis of Tcf-1 gene and identification of Tcf-1 gene expression in marrow CD4~+ T cells from aplastic anemia patientsObjective: To complete the bioinformatics analysis of Tcf-1 gene from the subtracted cDNA library to obtain its information of gene and protein. To identify Tcf-1 gene expression in marrow CD4~+ T cells from aplastic anemia patients.Methods: The expression profile and gene location of Tcf-1 gene and basal characters and functional domains of Tcf-1 protein were analysed through Internet databases. Expression of Tcf-1 mRNA in marrow CD4~+ T cells from aplastic anemia patients was assayed by semi-quantitative reverse-transcription polymerase chain reaction (RT-PCR).Results: Tcf-1 gene was mainly expressed in thymus, it was also in the uncharacterized tissue, connective tissue, prostate, spleen, lymph node, colon, heart, liver, blood and so on. It was located chromosome 5q31.1. Its protein consisted of 269 aa, and its molecular formula was C1355H2108N386O378S10. The molecular weight was 30174.6 and theoretical isoeleetrie point was 9.82. Tcf-1 protein was a hydrophilic protein, and was not a membrane protein. It lied mainly in cell nuclear. Tcf-1 protein had an HMG-BOX domain that was located between 154 and 222 aa. As a result of semi-quantitative RT-PCR, compared with the normal donors, Tcf-1 gene was up-expressed in marrow CD4~+ T cells of patients with aplastic anemia.Conclusion: As T-cell special expression gene, Tcf-1 had an HMG-BOX domain which made it be cognized as a transcription factor. Tcf-1 mRNA expression level of marrow CD4~+ T cells from aplastic anemia patients was markedly higher than that of normal people. Partâ…¤The effects of Tcf-1 gene silence on marrow CD4~+ T cells from aplastic anemia patientsObjective: To discuss the effects of Tcf-1 gene silence on marrow CD4~+ T cells from aplastic anemia patients.Methods: The shRNA expression vectors psiRNA1, psiRNA2 and psiRNA3 were constructed with psiRNA-hH1neo G2 plasmid. After they were transfected into Jurkat cells, the expression level of Tcf-1 mRNA in Jurkat cells was assayed by semi-quantitative reverse-transcription polymerase chain reaction. After the selected psiRNA2 were transfected into marrow CD4~+ T cells from aplastic anemia patients, the expression levels of Tcf-1, c-myc and CD44 mRNA in marrow CD4~+ T cells from aplastic anemia patients was detected by semi-quantitative RT-PCR.Results: Three plasmid-derived siRNAs could effectively reduce the expression level of Tcf-1 mRNA in transfected Jurkat cells. The plasmid-derived siRNA psiRNA2 was found to be the most effective inhibitor of Tcf-1 expression. After the selected psiRNA2 were transfected into marrow CD4~+ T cells from aplastic anemia patients, the expression levels of Tcf-1, c-myc and CD44 mRNA in marrow CD4~+ T cells from aplastic anemia patients were reduced to different extents.Conclusion: The up-expression of Tcf-1 gene could be closely related to abnormal functions of marrow CD4~+ T cells from aplastic anemia patients. It could regulate downstream target genes such as c-myc and CD44 to take part in the mechanisms of over-proliferation, activation and excreting certain soluble humoral agents which could inhibit hematopoietic stem cell proliferation of marrow CD4~+ T cells from aplastic anemia patients. It was worthwhile to carry out the study of the new therapy against Tcf-1 gene in aplastic anemia. | | Keywords/Search Tags: | aplastic anemia, CD4~+T cell, proliferation, apoptosis, cytokine, suppressive subtractive hybridization, sequencing, homology, gene, Tcf-1, bioinformatics, RT-PCR, RNA interference, siRNA, c-myc, CD44 | | Related items |
| |
|