| Background: As a major cellular component of blood vessels, smooth muscle cells (SMC) play an important role under physiological conditions as well as in a large number of human diseases, including atherosclerosis, hypertension and cancer. Unlike either skeletal or cardiac muscle those are terminally differentiated, SMC possess remarkable plasticity and undergo phenotypic switch at different stages of development, even in adult organisms. The phenotypic switch from a quiescent, contractile differentiation state to a highly proliferative, synthetic dedifferentiation state of SMC is believed to contribute to pathogenesis of many SMC-related diseases. An full understanding of the normal regulation of SMC development, maturation and differentiation will not only provide the foundation for elucidating how these processes may be disrupted in vascular disease, accelerating appreciation of pathogenesis and providing novel therapeutic targets, but will also be critical to understanding congenital defects in vascular development. In addition, an appreciation of normal SMC developmental mechanisms may also contribute to novel cell-based therapies for SMC-related diseases as well as for tissue engineering and reconstruction. To achieve the goals mentioned above, SMC recapitulating normal development and maturation are badly needed.Unfortunately however, the mechanisms underlying SMC development and maturation are poorly understood partly due to the lack of good in vitro and in vivo models. For example, SMC separated from adult tissues, which are widely used in mechanism study for phenotype switch, neither recapitulate normal SMC differentiation nor maintain contractile function when cultured in vitro, so their usefulness in differentiation study is limited. Other models like induction of 10T1/2 cells, neural crest-derived MONC-1 cells, P19 embryonal carcinoma cells and even adult stem cells by different agents produce cells expressing several SMC markers, but whether the cells undergo differentiation similar to in vivo process are questionable due to their controversial origin.Embryonic stem cell (ESC) lines have been previously established from the inner cell mass of blastocysts and have been shown to have the potential to generate all embryonic cell lineages when they undergo differentiation. When cultured suspendedly, ESC spontaneously differentiates into cyst-like structures, termed embryoid bodies (EB), which contain derivatives of the three primitive germ layers. EB have been shown to form regions of visibly spontaneously contractile SMC which indicates SMC derived from ESC recapitulate SMC differentiation and maturation, so it seems that ESC-EB system is an ideal model for differentiation study of SMC. But this model also has a defect, pluripotency of ESC not only provide environmental clues favoring development of various functional cell types, but also make study of specific cell type (like SMC) difficult due to"contamination"of other non-interested cells derived from ESC. To overcome all these disadvantages, purification of functional SMC from background of all cell type derived from ESC is needed.Objective: To develop a novel method to obtain purified population of SMC derived from ESC by using puromycin resistance gene expressing vector driven by smooth muscle specific promoter, and then to assess the biological function of these cells.Methods:1. Construction of plasmid encoding puromycin resistance gene (also known as puromycin acetyl transferase gene or pac gene) and enhanced green fluorescence protein (EGFP) under the control of SM22αpromoter(1) Clone of SM22αpromoter: The 541bp SM22αpromoter that works specifically in smooth muscle lineage cells was amplified from mouse genomic DNA using PCR with forward primer: AGTTATATTAATTTTGCATAGTGCCTGGTTG; and reverse primer: GCGCTAGCTACAAGGCTTGGTCGTTTG. The PCR product was cloned into the pMD18-T Simple vector, and was subsequently excised with AseI/NheI and subcloned into the same sites of the pIRES2-EGFP vector, removing the CMV promoter. The intermediate vector was termed pSM22α-IRES2-EGFP. (2) Clone of pac gene: The 663 bp pac gene was excised from pSM2C with HindIII/ClaI and subcloned into pSUPER.basic to produce pSUPER-PAC. (3)By using enzyme BglII/AccI, pac gene was cut from pSUPER-PAC and subsequently inserted into pSM22α-IRES2-EGFP to construct pSM22α-PAC-IRES2-EGFP, which encodes pac gene and EGFP under the control of SM22αpromoter. The constructed vectors were identified by DNA sequencing and further verified in both murine microvascular endothelial cell (EC) line SVEC and SMC to see whether the promoter can work.2. Culture of ESC and generation of transgenic ESCFeeder cells, mouse embryonic fibroblasts (MEF), were prepared from mouse fetuses harvested between day 12.5-14.5d of gestation. Before use, MEF were treated with Mitomycin C for 2 hours. Mouse ESC R1 were routinely cultured on treated MEF. Cells were fed every day and replated every second day. Before transfection, ESC trypsinized to single cell suspension were cultured on plate coated by 0.1% gelatin without feeder layer. Then ESC were transfected with linearized pSM22α-PAC- IRES2-EGFP plasmid DNA using lipofectamine for 5 hours. Transgenic ESC clones were selected by culture medium with 500 ug/mL G418 24 hours after transfection. Colonies derived from single cells under G418 selection were picked and amplified and screened for the presence of the pac gene by reverse transcription polymerase chain reaction (RT-PCR). Transgenic ESC were termed as SPIE-ESC.3. EB Culture, induced differentiation and SMC purificationTo generate EB, SPIE-ESC were typsinized to single cells and cultured in suspension in a petri dish with differentiation medium without LIF. On day 6, suspended EB were plated onto a surface coated with 0.1% gelatin in differentiation medium supplemented with 10 nmol/L all-trans retinoic acid (ATRA). The culture was continued for 5 days with a daily change of fresh ATRA-containing differentiation medium. On day 11, SMC were selected by differentiation medium containing 10μg/mL puromycin for 3 days. The dead cells were removed by a PBS washing every day after selection. The sorted cells were replated in a new plate after selection. The purified SMC were termed as SM22α-SMC. The homogeneity of the population was determined by flow cytometry.4. Flow cytometryUnsorted SPIE-ESC and sorted SM22α-SMC were trypsinized and passed through a 70μm filter to obtain single cell suspension. Acquisition of 10 000 events was made with FACScan and data analysis was done with CellQuest software. The cells derived from normal ESC were used as a negative control. 5. ImmunocytochemistrySM22α-SMC were plated on 0.1% gelatin-coated cover slips and cultured in differentiation medium. Cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100 and blocked with 5% BSA. Primary antibodies were mouse anti-SMα-actin and rabbit anti-SM myosin heavy chain (SM-MHC) and rabbit anti-SM22α. After cells incubated with corresponding tetramethyl rhodamine iso-thiocyanate (TRITC) conjugated secondary antibodies and counterstained with DAPI, cover slips were sealed and examined by fluorescence microscopy.6. Western blot analysisRat primary aortic SMC, unsorted cells derived from ESC and sorted SM22α-SMC were disrupted in lysis buffer. Samples were centrifuged and clear supernatants were collected. Protein concentration was determined using BCA protein assay kit. Equal amounts of proteins were run on a 10% SDS-PAGE gel and transferred to a PVDF membrane. Nonspecific binding sites were blocked by incubation with 5% nonfat dry milk in TBS-T. The primary antibodies used for Western analysis were as follows: mouse anti-SMα-actin, rabbit anti-SM22α, and rabbit anti-SM MHC. The specific binding was detected with horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence reagents.7. Contractile assayPurified SM22α-SMC were plated onto 0.1 % gelatin coated cover slips with differentiation medium. After 24 hours, fresh medium was replenished and added with Carbachol at a final concentration of 10μmol/L. Pictures were acquired at 30 second intervals for 15 min. Average cell area reduction of 10 SM22α-SMC were calculated and compared to negative control SVEC.8. Matrigel assay of SMC recruitmentEqual amount of 1×104/mL murine microvascular endothelial cell line SVEC and sorted SM22α-SMC were mixed and plated on cover slips coated by Matrigel (BD) with differentiation medium. SMC localization was examined by fluorescence microscope at 12h or 60 h. SVEC cultured alone on Matrigel were used to observe the tube like structure formation.9. Statistical analysisAll experiments were performed in duplicates or triplicates and were repeated at least three times. Data analyses were performed using SPSS 11.1 software. Quantitative data were presented as means±standard deviation (SD). Differences between two groups were analyzed by two-tailed Student's t test and were considered significant when p< 0.05.Results:1. Construction of plasmid vector pSM22α-PAC-IRES2-EGFPResults of DNA sequencing showed that the plasmid vector was successfully constructed. Further verification of the vector in EC and SMC showed that it works in SMC but not in SVEC.2. Generation of SPIE-ESC and isolation of ESC Derived SM22α-SMCAfter 2 weeks selection with G418, positive ESC colonies were picked and amplified. Detection of pac gene transcription by RT-PCR showed that four colonies were successfully transfected with pSM22α-PAC-IRES2-EGFP. ATRA induced differentiation of transgenic ESC to EGFP expressing SM22α-SMC detected by fluorescence microscope. SM22α-SMC located peripherally in the EB outgrowth. In the absence of puromycin, cell colonies with the typical cell morphology of undifferentiated cells remained. In contrast, when cells were treated with puromycin for an additional 3 days, only EGFP expressing SM22α-SMC were observed. These SMC showed a spindle like shape similar to rat aortic SMC.3. Selected SM22α-SMC has a high purity of 99%The amount of EGFP expressing SM22α-SMC in the 10-day-old differentiated SPIE-ESC in the presence of ATRA, or in the presence of both ATRA (for 10 days) and puromycin (for 3 days) as quantified by fluorescence-activated cell sorter analysis was 40.05% and 98.99% respectively.4. Expression of SM22α-SMC with smooth muscle specific markersImmunofluorescence studies of the selected cells showed that SM22α-SMC stained for the SMC selective markers, SMα-actin and SM-MHC. All the SM22α-SMC stained strongly for SM22α. The cells displayed SMC-like morphology and appearance with a well-developed actin stress fiber network. Immunoblotting analyses revealed that the levels of SM22αproteins in purified SM22α-SMC group were higher than unpurified group, while comparable to rat aortic SMC group. The highly selective SMC protein, SM-MHC, expressed in the purified cell population after puromycin selection were higher than unpurified group and a little lower than rat aortic SMC group. The levels of SMα-actin are similar in three groups.5. SM22α-SMC contracted in response to carbacholSM22α-SMC showed significant contraction after carbachol treatment, with an average of 28±6.4% cell area reduction. No obvious response to carbachol was observed on SVEC.6. SM22α-SMC integrated into tube like structure in a Matrigel assaySVEC seeded alone on Matrigel formed tube like structures after either 12 h or 60 h culture. SM22α-SMC/SVECs formed similar structures at the same time points observed under phase contrast microscope. Under fluorescence microscope, EGFP expressing SM22α-SMC were seen to integrated into the tube like structures formed by SVEC.Conclusions: By using a novel vector expressing pac gene and EGFP under control of smooth muscle specific SM22αpromoter, we successfully obtained highly purified and functional SMC derived from ESC. |