| BackgroundAtherosclerosis is a long-term chronic disease characterized by the accumulation of lipids and fibrous connective tissue in the large arteries,accompanied by a local inflammatory response.Inflammatory cells,like T lymphocytes and macrophages, play an important role in all stages of atherosclerotic lesion development.Moreover, cells from the vessel wall,like endothelial cells,smooth muscle cells,adventitial fibroblasts and mast cells,are able to act as immunological cells that produce proinflammatory cytokines.The triggers and pathways of initiation and regulation of the immune responses in atherosclerotic disease are largely unknown.In general,the human immune system has two closely related pathways to respond to potentially harmful agents:the innate and the adaptive immune recognition systems.The adaptive immune system involves dynamic adaptation to unique antigenic epitopes that are present in the environment.The innate immune response is the first line of defense in which highly conserved pathogen motifs,entitled pathogen-associated molecular patterns(PAMPs),are recognized.That atherosclerosis is a chronic inflammatory disease,highlighting the pivotal role played by the immune system,leads inevitably to the question of which molecule and downstream signal pathway might dominate inflammatory responses within arteries.In many current discussions of inflammatory states,the subject of toll-like receptors(TLRs) is bound to arise.The response of TLRs in atherosclerosis and finding a novel potential target for intervention in these processes is important.Toll-like receptors(TLRs) are a group of receptors that play a key role in innate immune signaling and in initiating inflammatory responses,possibly in atherosclerosis.To date,11 human and 13 mouse TLRs have been cloned.TLRs have a short intracellular TolI/IL-1R(TIR) domain,which,upon ligand binding,results in recruitment of adapter molecules and induction of downstream activation.Activation of one or more TLRs(either as homomeric or heteromeric assemblies) causes the recruitment and activation of adaptor proteins such as myeloid differentiation factor 88(MyD88),then recruitment of members of the IL-1R-associated kinase(IRAK) family and activation of tumor necrosis factor(TNF) receptor-associated factor 6 (TRAF-6) and ultimately nuclear factor-kappa B(NF-kB).Of the 11 human TLR-subtypes,TLR4 is strongly expressed in the healthy human artery,although each of the four main TLRs(TLR 1,2,4 and 6) involved in the recognition of lipids are considerably upregulated in diseased arteries.TLR2 and TLR4 are the best studied and are generally believed to be involved in the pathogenesis of cardiovascular disease.They are expressed in most cardiovascular cells,such as endothelial cells,smooth muscle cells,macrophages and adventitial fibroblasts.Activation of these cells as a response to self- and non-self ligands appears to be mediated by TLR2 and TLR4.In atherosclerosis,apolipoprotein E (apoE)-/- mice show accelerated atherosclerosis after TLR2 or TLR4 ligand stimulation.Several lines of evidence suggest that TLRs are proatherogenic.In mice lacking TLR4,small neointimal lesions developed after vascular injury,and TLR2 has similar effects.Recent study showed both TLR2 and TLR4 expression significantly increased over time in the arterial lesions of apoE-/- mice.Recent animal studies showed that MyD88 and TLR4 play an important role in atherosclerotic plaque accumulation.As well,local TLR2 stimulation in the femoral artery in apoE-/- mice accelerated atherosclerosis.These results support those of a study demonstrating impaired atherosclerotic lesion development in TLR2-/-/LDLR-/- mice. Recently,small interfering RNAs(siRNAs) have been efficacious in silencing target genes by means of RNA interference(RNAi),a natural mechanism conserved in nature from yeast to humans,and lentiviral vectors can efficiently deliver siRNA because they are capable of stably transducing both dividing and nondividing cells.In this study,we constructed two lentiviral vectors aimed at knocking down TLR2 and TLR4 to elucidate their roles in atherosclerosis in apoE-/- mice by stabilizing plaque.Objectives1.To construct lentiviruses targeting mouse TLR2 or TLR4 small interfering RNA (siRNA).2.Constricting collars were placed around the carotid arteries of apolipoprotein E (apoE)-/- mice to induce formation of atherosclerosis plaque.The two lentiviruses were transfected into carotid lesions separately or together.Plaque characteristics were analyzed.3.Combined interfering TLR2 and TLR4 gene on atherosclerosis plaque to study the synthetic effect between TLR2 and TLR4.Methods1.Cell cultureRAW264.7 mouse macrophage cell line purchased from the American Type Culture Collection(Rockville,MD) was routinely maintained in RPMI-1640 medium (Sigma,St.Louis,MO) supplemented with 10%fetal bovine serum,at 37℃in humidified air containing 5%CO2.The 293FT cell line(invitrogen,Carlsbad,CA), which stably expresses SV40 large T antigen and facilitates the optimal production of viruses,was cultured in Dulbecco's modified Eagle's medium(GIBCO,Grand Island, NY).2.Lentiviral vector constructionFirst,we selected three different sequences(siteA,siteB,siteC) for targeting the TLR2 and TLR4 genes using the BLOCK-R RNAi Designer(Invitrogen) (http://maidesigner.invitrogen.com).targeted sequence of TLR2-siteA was 5'-TGCTGAATAGAGGTGAAAGACCTGGAGTTTTGGCCACTGACTGACTCCA GGTCTCACCTCTATT-3';targeted sequence of TLR2-siteB was 5'-TGCTGTGTACTGGACAAATTCAGGAAGTTTTGGCCACTGACTGACTTCCT GAATGTCCAGTACA-3';targeted sequence of TLR2-siteC was 5'-TGCTGAAAGGCATCATAGCAAACGTCGTTTTGGCCACTGACTGACGACG TTTGATGATGCCTTT-3';targeted sequence of TLR4-siteA was 5'-TGCTGTATGCAGGTAACTTACAGGAAGTTTTGGCCACTGACTGACTTCCT GTATTACCTGCATA-3';targeted sequence of TLR4-siteB was 5'-TGCTGTTCACGTAGAAACTGTAAGTCGTTTTGGCCACTGACTGACGACTT ACATTCTACGTGAA-3';targeted sequence of TLR4-siteC was 5'-TGCTGTGCACATGTCATTTGTTCAACGTTTTGGCCACTGACTGACGTTGA ACATGACATGTGCA-3'.A scrambled siRNA sequence(named mock-siRNA) with no known homology to mammal genes served as a control.The preparation of lentiviral vectors expressing human TLR2 and TLR4 involved use of the BLOCK-It Lentiviral PolⅡmiR RNAi Expression System(catalog no.K4948-00;Invitrogen) following the manufacturer's instructions.In brief,three TLR2(siteA,B,C) and three TLR4(siteA,B,C) PolⅡsiRNA expression vectors containing the respective mouse TLR2 and TLR4 siRNA-expressing cassettes were constructed.A replication-incompetent lentivirus was produced by cotransfeetion of the siRNA-expression vector and ViraPower packaging mix(Invitrogen) containing an optimized mixture of three packaging plasmids--pLP1,pLP2,and pLP/VSVG--into 293FT cells.Viral supernatant was harvested 48 h after transfection,filtered through a 0.45-μm cellulose acetate filter and frozen at -70℃.The three TLR2i lentiviruses (siteA,B,C) and three TLR4i lentiviruses(siteA,B,C) were transfected into RAW264.7 cells.Five days after transfection,cells were collected for real-time PCR and western blot analysis to select the most effective targeting site for the TLR2 and TLR4 genes to amplify.The siRNA mock vector containing lentivirus only was used as a control.Finally,three lentivirus vectors were produced:TLR2i-,TLR4i-,and mock,and the terminal virus titer was 2×109 TU/mL.3.Animal protocol Male apoE-/- mice(n=140),aged 10 to 12 weeks,were purchased from Beijing Laboratory Animal Research Center.Mice were kept on a 12-h light/12-h dark cycle with food and water freely available.All animals received a high-fat diet(0.25% cholesterol and 15%cocoa butter) for 12 weeks.All animal care and procedures were approved by Shandong University Institutional Animal Care and Use Committee and complied with the Guide for the Use and Care of Laboratory Animals published by the US National Institutes of Health(NIH publication 80-23,revised 1996)4.Carotid collar placement and lentivirus injectionAll mice were anesthetized with an intraperitoneal injection of pentobarbital sodium(40 mg/kg).As described by vonder Th(u|¨)sen et al.,a constricting silastic tube (0.30-mm inner diameter,0.50-mm outer diameter,and 2.5-mm long;Shandong Key Laboratory of Medical Polymer Materials,Jinan,China) was placed on the right common carotid artery near its bifurcation.Eight weeks after surgery,the collars were removed and lentiviral suspension was instilled into the right common carotid artery via the external carotid.The suspension was left in situ for 15 min after temporary ligation of the proximal common carotid artery and the internal carotid artery,and subsequently drawn off before ligation of the external carotid and closure of the skin wound with silk sutures as described.The mice were randomly divided into five groups according to lentivirus injection:control,no lentivirus;mock,10μL mock lentiviral suspension;TLR2 interfering(TLR2i),10μL TLR2i lentiviral suspension; TLR4 interfering(TLR4i),10μL TLR4i lentiviral suspension;and TLR2+4i,5μL each of TLR2i and TLR4i lentiviral suspension.Control and mock groups were non-knockdown groups,and TLR2i,TLR4i and TLR2+4i groups were gene-knockdown groups.5.Serum lipid measurementBefore perfusion-fixation,blood was collected from the inferior vena cava. Serum total cholesterol,triglycerides,low-density lipoprotein(LDL) cholesterol,and high-density lipoprotein(HDL) cholesterol concentrations were measured by enzymatic assay(Zhejiang Dongou Biotechnology,Wenzhou,China)6.Tissue preparation and histological analysis Mice were perfused with phosphate-buffered saline through the left ventricle and then underwent peffusion fixation at 100 mm Hg with 4%formaldehyde(pH 7.2) for 2 and 15 min.The right common carotid artery with bifurcation was carefully excised and immersed in 4%formaldehyde overnight(4℃),embedded in OCT compound, and stored at -20℃until use.Each vessel throughout the entire length of the carotid artery underwent histological analysis.In the 6 mice of the mock group sacrificed at week 9 and week 10,Sky Blue 6B (Sigma C8679) was used to eliminate background autofluorescence and cryosections were viewed under fluorescence microscopy to identify GFP expression.In all of the mice,OCT-embedded carotid artery was cross-sectioned into pieces 6μm thick at 50-μm intervals.Five cross sections in each mouse were used for a particular type of staining and the whole cross section viewed in one field was used for quantitative measurements.Sections were stained with hematoxylin and eosin for histological analysis.The plaque area was calculated by subtracting the lumen area from the area circumscribed by the internal elastic lamina.The plaque was subdivided into a fibrous cap and a necrotic core on the basis of extracellular matrix staining by HE,which was further confirmed by staining for collagen and lipids using picrosirius red and Oil-red O,respectively.Corresponding sections on separate slides were immunostained with monoclonal antibodies.Smooth muscle cells(SMCs) and macrophages were immunostained with anti-α-actin antibodies(1:1000;Sigma) and MOMA-2(1:25; Serotec,Oxford,UK),respectively.After incubation with the appropriate horseradish peroxidase(HRP)-conjugated secondary antibodies(1:100;Zhongshan Biological Technology,Wenzhou,China),the sections were incubated with 3',3'-diaminobenzidine and counterstained with hematoxylin.Sections reacted with non-immune IgG,secondary antibody only and no primary and secondary antibodies were used as negative controls.An automated image analysis system(Image-Pro Plus 5.0,Media Cybernetics,USA) was used for quantitative measurements.The positive staining area of macrophages,SMCs,lipids and collagen was quantified by computer-assisted color-gated measurement,and the ratio of positive staining area to the intimal area was calculated.The vulnerability index was calculated by the following formula:positive staining area of(macrophages +lipid)/positive staining area of(α-SMCs +collagen).7.Transmission electron microscopyTissues for TEM were prepared as previously described.Tissue samples were trimmed into small pieces and fixed in chilled 2.5%glutaraldehyde in 0.1 M cacodylate buffer(pH 7.4) for 2 h and then postfixed in osmium tetroxide dissolved in the same buffer for 1-2 h.They were dehydrated through a graded series of ethanol and propylene oxide and embedded in epoxy resin.The embedded blocks were cut into ultrathin sections,then stained with lead citrate and uranyl acetate and observed under a 12A electron microscope(Hitachi,Japan).8.Quantitative real-time RT-PCR analysisRNA was extracted with TriZol Reagent(Invitrogen) following the manufacturer's instruction.The mRNA levels of TLR2,TLR4,interleukin-1β(IL-1β), IL-6,tumor necrosis factor-α(TNF-α),and monocyte chemoattractant protein-1 (MCP-1) were quantified in in vitro RAW264.7 cells and in vivo fresh carotid plaque tissue by use of SYBR Green technology(Applied Biosystems).Quantitative values were obtained from the threshold cycle value(Ct).The housekeeping geneβ-actin was quantified as an internal RNA control.The "2-△△CT method" for comparing relative expression results was applied as described.9.Western blot analysisEqual amounts of protein from in vitro RAW264.7 cells and in vivo fresh carotid plaque tissue were separated on 14%SDS-PAGE and transferred to nitrocellulose membrane.Following blocking with 5%non-fat milk,the blots were washed with PBS containing 0.1%Tween 20 and incubated with an appropriate primary antibody at 4℃overnight.The blots were probed with antibodies againstβ-actin(1:100, Zhongshan,China),as well as TLR2(1:500),TLR4(1:200).After overnight incubation,the blots were washed with TBST and incubated with secondary antibody conjugated to HRP(1:1000,Zhongshan),then washed again.The blots were then visualized by enhanced chemiluminescence. 10.Data AnalysisData were expressed as mean±SD.Multiple comparisons were analyzed by LSD post hoc tests.Factorial ANOVA was used to analyze the individual and interactive effects of two independent variables,TLR2i and TLR4i.With the statistical design of 2 x 2 factorial,the main effects of TLR2i,main effects of TLR4i and the interaction between TLR2i and TLR4i were compared.In such an analysis,if a significant interaction is present,the effects between TLR2i and TLR4i should be interpreted as synergistic rather than additive.All analyses involved use of SPSS 11.5 (SPSS Inc.,Chicago,IL).P<0.05 was considered statistically significant.Results1.Gene silencing in vitro:screening the most effective targeting sites for the TLR2 and TLR4 genes by real-time PCR and western blot analysis.RAW264.7 cell line was transfected with lentivirus-based vectors expressing three different TLR2-siRNAs and gene silencing analysis showed that the TLR2i-site B lentivirus was the most effective vector in blocking TLR2 expression. TLR2-knockdown clone A,clone B,and clone C exhibited 56%,81%,and 62% reduction,respectively,in the level of TLR2 mRNA expression and 50%,62%,and 35%reduction,respectively,in the level of TLR2 protein expression.The TLR4i-site C lentivirus was found to be the most effective vector in blocking TLR4 expression.TLR4 knockdown clone A,clone B,and clone C exhibited 61%,54%,and 72%reduction,respectively,in the level of TLR4 mRNA expression and 45%,32%,and 61%reduction,respectively,in the level of TLR4 protein expression.As a result,TLR2-site B and TLR4-site C lentiviruses were selected for further in vivo studies.2.Efficient transfection of lentivirus in atherosclerosis plaquePrevious local virus delivery to pre-collar-induced carotid artery lesions of apoE-/- mice had resulted in efficient transfection to atherosclerosis plaque.Since GFP expression provides an efficient,convenient monitor to check transfection efficiency of lentivirus,we detected GFP fluorescence in carotid artery plaques 1 week after transfection,which indicated transfection of the siRNA,and greater fluorescence at 2 weeks after transfection.When the study was terminated,four weeks after transfection,GFP was still visible,although weak.These results demonstrated the efficient in vivo transfection of lentivirus by siRNA in atheroselerotie plaque.The virus local transfection did not affect normal functioning of the animals and did not result in weight change(30.6±3.1g in transfected mice vs.29.9±3.5g in controls) or serum cholesterol level(29.6±2.6 vs.30.1±2.0 mmol/L).3.Gene silencing in vivo:effect of knockdown of siRNA lentivirus on TLR2 and TLR4 expression in atheroselerosis plaque by real-time PCR and western blot analysis.To evaluate the efficacy of lentivirus-mediated gene silencing in vivo,we tested atherosclerosis plaque for TLR2 and TLR4 mRNA and protein expression levels.The TLR2 mRNA levels were lower,by 50%and 59%,in the TLR2i group and TLR2+4i group,respectively,than in the control group(P<0.05 for each).The TLR4 mRNA levels were lower,by 48%and 53%,in the TLR4i and TLR2+4i groups,respectively, than in the control group(P<0.05 for each).The mock,TLR2i and TLR4i groups showed no significant change in TLR4 or TLR2 mRNA level,respectively.TLR2 protein was lower in the TLR2i and TLR2+4i groups than in the other groups,as was TLR4 protein lower in the TLR4i group and TLR2+4i group than in the other groups.So the local application of siRNA-lentivirus can efficiently silence gene expression in vivo.4.Effect of TLR2i and TLR4i on plaque featuresThe atherosclerotie plaque composition of collagen,lipid,macrophages,and SMCs was demonstrated by histological and immunohistochemieal staining.The gene-knockdown groups showed higher content of collagen and lower content of lipid and macrophages than the non-knockdown groups(P<0.05 for all).Moreover,plaques in the TLR2+4i group showed a significant change as compared with plaques in the TLR2i- and TLR4i-alone groups(P<0.05 each).ANOVA revealed TLR2i and TLR4i significantly related in terms of macrophage and collagen content(P<0.05 for each) and TLR4i was shown to increaseα-SMC content in TLR4i and TLR2+4i groups (P<0.05 for each),with no differences in SMCs among other groups. Both TLR2i and TLR4i induced markedly increased cap thickness(P<0.05 for all).Furthermore,the combination of TLR2i and TLR4i resulted in significantly increased mean cap thickness(P<0.05).The vulnerable index differed significantly between gene-knockdown groups and non-knockdown groups,with 1.00±0.25 for the TLR2+4i group,signifieantly smaller than that of the other groups(2.09±0.17 for control,2.06±0.14 for mock,1.40±0.27 for TLR2i,and 1.38±0.19 for TLR4i groups;P<0.05 for all).The gene-knockdown groups showed a lower accumulation of lipids and macrophages,a higher content of collagen,thicker fibrous caps and reduced vulnerable index than non-knockdown groups,with a synergistic combination effect of TLR2i and TLR4i on maerophage and collagen content and the mean cap thickness.5.Gene knockdown effect on the ultrastructure of atherosclerosis plaqueThe non-knockdown group ultrastucture consisted of foam cells and severely discontinuous innermost lining of endothelial cells,with wide gaps between adjacent cells and more synthetic(increased rough endoplasmic reticulum) SMCs than a contractile phenotype(cytoplasmic filaments prominent).Lipid-filled macrophages, characterized by numerous variable-sized granules and lipid droplets,were also present in the intima.The extracellular matrix contained fragmented elastic tissue, myelin figures,necrotic debris,and cholesterol clefts.In the gene-knockdown group ultrastructure,the endothelial cells were smooth with integrity.Both synthetic and contractile types of SMCs were present,and the cytoplasm had more fine filaments,with dense bodies,decreased rough endoplasmic reticulum,mitoehondrial number and cytoplasmic lipid level.Foam cells were reduced in number as were extracellular matrix lipid droplets.6.Effect of TLR2i and TLR4i on inflammation within lesionsThe mRNA expression level of IL-6 and MCP-1 in the TLR2i subgroup and that of IL-1β,IL-6,TNF-αand MCP-1 in the TLR4i subgroup were lower than the corresponding measurements in the control or mock subgroups(all P<0.05).The TLR2+4i subgroup showed a significantly lower mRNA expression level of IL-1β, IL-6,TNF-α,MCP-1 than the other four subgroups(P<0.05).Furthermore,the synergistic effect of TLR2i and TLR4i in the reduction of the mRNA expression level of these cytokines was confirmed by Factorial ANOVA analysis(P<0.05).Conclusions1.In the present study,we applied lentivirus-mediated RNAi methods to efficiently knock down mice TLR2 and TLR4 genes in vitro and in vivo.2.In vivo study demonstrated that transfected lentiviruses could silence TLR2 and TLR4 expression in apoE-/- mice with collar-induced carotid plaques,then decrease the level of inflammatory cytokines,and finally postpone the progression of atherosclerosis by stabilizing plaques.3.Moreover,we found a synergistic effect between TLR2i and TLR4i in preventing atherosclerosis progression.These results point to a potential role for knockdown of TLR2 and TLR4 in local therapy for atherosclerosis. BackgroundAtherosclerosis is a complicated inflammatory process with immune reactions during the initiation and progression of the disease.Toll-like receptors(TLRs) are known to play a key role in innate immune signaling and initiating inflammatory responses and their potential roles in the pathogenesis of atherosclerosis have received great attention.To date,11 human and 13 mouse TLRs have been cloned.TLRs have a short intracellular Toll/IL-1R domain,which,upon ligands binding,results in recruitment of adapter molecules and induction of downstream activation.Activation of one or more TLRs(either as homomeric or heteromeric assemblies) causes the recruitment and activation of adaptor proteins,and ultimately,nuclear factor-kappa B (NF-κB),which leads to stimulated release of a large number of inflammatory cytokines such as interleukin-6(IL-6),and chemoattractant cytokines such as monocyte chemoattractant protein-1(MCP-1).Of the 11 human TLR-subtypes,TLR2 and TLR4 are the best studied and are generally believed to be involved in the pathogenesis of atherosclerosis.They are highly expressed in most vascular cells,such as endothelial cells,smooth muscle cells (SMCs),macrophages and adventitial fibroblasts.Studies in mice found that TLR2 played a critical role in the progression of atherosclerosis that was independent of dietary lipids,and TLR2 has to form dimers with other receptors such as TLR1 or TLR6 for signaling.TLR1 was also detected in atherosclerotic plaques,especially in areas infiltrated with inflammatory cells although the expression of TLR1 was found to be lower than that of TLR2 and TLR4.However,whether TLR1 and TLR2 are involved in the pathogenesis of vulnerable plaques is unknown.Since both TLR1 and TLR2 are expressed in atherosclerotic plaques and TLR2 may integrate with TLR1 or other TLRs for signaling,we hypothesized that TLR1 and TLR2 may play different roles in the formation of vulnerable plaques and combinatorial knockdown of TLR1 and TLR2 genes may enhance the effects of isolated knockdown of TLRI or TLR2 gene on plaque stabilization.Recently,small interfering RNAs(siRNAs) have proven efficacious in silencing target genes and lentivirus can efficiently deliver siRNA because they are able to transduce both dividing and nondividing cells stably.In this study,we constructed two lentiviral vectors to knockdown TLR1 and TLR2 to elucidate their individual and synergistic roles in stabilizing atherosclerotic plaques in apolipoprotein E(apoE)-/-mice.Objectives1.To construct lentiviruses targeting mouse TLRI or TLR2 small interfering RNA(siRNA).2.Constricting collars were placed around the carotid arteries of apolipoprotein E(apoE)-/- mice to induce formation of atherosclerosis plaque.The two lentiviruses were transfected into carotid lesions separately or together.Plaque characteristics were analyzed.3.Combined interfering TLR1 and TLR2 gene on atherosclerosis plaque to study the synthetic effect between TLR1 and TLR2.Methods1.Cell cultureRAW264.7 mouse macrophage cell line purchased from the American Type Culture Collection(Rockville,MD) was routinely maintained in RPMI-1640 medium (Sigma,St.Louis,MO) supplemented with 10%fetal bovine serum,at 37℃in humidified air containing 5%CO2.The 293FT cell line(Invitrogen,Carlsbad,CA), which stably expresses SV40 large T antigen and facilitates the optimal production of viruses,was cultured in Dulbecco's modified Eagle's medium(GIBCO,Grand Island, NY). 2.Lentiviral vector constructionFirst,three different sequences(site A,B and C) of TLRI and TLR2 genes in mice were selected as the target for RNA interference(RNAi),using the BLOCK-It RNAi Designer(invitrogen)(http://maidesigner.invitrogen.com).Targeted sequence of TLR1-siteA was 5'-TGCTGATTAAAGGAGAGGTCCAAATGGTTTTGGCCACTGACTGACCATTT GGATCTCCTTTAAT-3';targeted sequence of TLR1-siteB was 5'-TGCTGTAAAGTAGTTGTTTGCAAGGGGTTTTGGCCACTGACTGACCCCTT GCACAACTACTTTA-3';targeted sequence of TLRl-siteC was 5'-TGCTGTAATGAAGGAATTCCACGTTGGTTTTGGCCACTGACTGACCAAC GTGGTTCCTTCATTA-3';targeted sequence of TLR2-siteA was 5'-TGCTGAATAGAGGTGAAAGACCTGGAGTTTTGGCCACTGACTGACTCCA GGTCTCACCTCTATT-3';targeted sequence of TLR2-siteB was 5'-TGCTGTGTACTGGACAAATTCAGGAAGTTTTGGCCACTGACTGACTTCCT GAATGTCCAGTACA-3';targeted sequence of TLR2-siteC was 5'-TGCTGAAAGGCATCATAGCAAACGTCGTTTTGGCCACTGACTGACGACG TTTGATGATGCCTTT-3'.A scrambled siRNA sequence(named moek-siRNA) with no known homology to mammal genes served as a control.The preparation of lentiviral vectors expressing human TLR1 and TLR2 involved use of the BLOCK-It Lentiviral PolⅡmiR RNAi Expression System(catalog no.K4948-00;Invitrogen) following the manufacturer's instructions.In brief,three TLR1(siteA,B,C) and three TLR2(siteA,B,C) PolⅡsiRNA expression vectors containing the respective mouse TLR1 and TLR2 siRNA-expressing cassettes were constructed.A replication-incompetent lentivirus was produced by cotransfection of the siRNA-expression vector and ViraPower packaging mix(invitrogen) containing an optimized mixture of three packaging plasmids--pLP1,pLP2,and pLP/VSVG--into 293FT ceils.Viral supernatant was harvested 48 h after transfection,filtered through a 0.45-μm cellulose acetate filter and frozen at -70℃.The three TLRIi lentiviruses (siteA,B,C) and three TLR2i lentiviruses(siteA,B,C) were transfected into RAW264.7 cells.Five days after transfection,cells were collected for real-time PCR and western blot analysis to select the most effective targeting site for the TLR1 and TLR2 genes to amplify.The siRNA mock vector containing lentivirus only was used as a control.Finally,three lentivirus vectors were produced:TLR1i-,TLR2i-,and mock,and the terminal virus titer was 2×109 TU/mL.3.Animal protocolMale apoE-/- mice(n=140),aged 10 to 12 weeks,were purchased from Beijing Laboratory Animal Research Center.Mice were kept on a 12-h light/12-h dark cycle with food and water freely available.All animals received a high-fat diet(0.25% cholesterol and 15%cocoa butter) for 12 weeks.All animal care and procedures were approved by Shandong University Institutional Animal Care and Use Committee and complied with the Guide for the Use and Care of Laboratory Animals published by the US National Institutes of Health(NIH publication 80-23,revised 1996)4.Carotid collar placement and lentivirus injectionAll mice were anesthetized with an intraperitoneal injection of pentobarbital sodium(40 mg/kg).As described by vonder Th(u|¨)sen et al.,a constricting silastic tube (0.30-mm inner diameter,0.50-mm outer diameter,and 2.5-mm long;Shandong Key Laboratory of Medical Polymer Materials,Jinan,China) was placed on the right common carotid artery near its bifurcation.Eight weeks after surgery,the collars were removed and lentiviral suspension was instilled into the right common carotid artery via the external carotid.The suspension was left in situ for 15 min after temporary ligation of the proximal common carotid artery and the internal carotid artery,and subsequently drawn off before ligation of the external carotid and closure of the skin wound with silk sutures as described.The mice were randomly divided into five groups according to lentivirus injection:control,no lentivirus;mock,10μL mock lentiviral suspension;TLR1 interfering(TLRli),10μL TLR1i lentiviral suspension; TLR2 interfering(TLR2i),10μL TLR2i lentiviral suspension;and TLR1+2i,5μL each of TLR1i and TLR2i lentiviral suspension.Control and mock groups were non-knockdown groups,and TLR1i,TLR2i and TLR1+2i groups were gene-knockdown groups. 5.Serum lipid measurementBefore perfusion-fixation,blood was collected from the inferior vena cava. Serum total cholesterol,triglycerides,low-density lipoprotein(LDL) cholesterol,and high-density lipoprotein(HDL) cholesterol concentrations were measured by enzymatic assay(Zhejiang Dongou Biotechnology,Wenzhou,China)6.Tissue preparation and histological analysisMice were perfused with phosphate-buffered saline through the left ventricle and then underwent perfusion fixation at 100 mm Hg with 4%formaldehyde(pH 7.2) for 2 and 15 min.The right common carotid artery with bifurcation was carefully excised and immersed in 4%formaldehyde overnight(4℃),embedded in OCT compound, and stored at -20℃until use.Each vessel throughout the entire length of the carotid artery underwent histological analysis.In the 6 mice of the mock group sacrificed at week 9 and week 10,Sky Blue 6B (Sigma C8679) was used to eliminate background autofluorescence and cryosections were viewed under fluorescence microscopy to identify GFP expression.In all of the mice,OCT-embedded carotid artery was cross-sectrned into pieces 6 lira thick at 50-μm intervals.Five cross sections in each mouse were used for a particular type of staining and the whole cross section viewed in one field was used for quantitative measurements.Sections were stained with hematoxylin and eosin for histological analysis.The plaque area was calculated by subtracting the lumen area from the area circumscribed by the internal elastic lamina.The plaque was subdivided into a fibrous cap and a necrotic core on the basis of extracellular matrix staining by HE,which was further confirmed by staining for collagen and lipids using picrosirius red and Oil-red O,respectively.Corresponding sections on separate slides were immunostained with monoclonal antibodies.Smooth muscle cells(SMCs) and macrophages were immunostained with anti-α-actin antibodies(1:1000;Sigma) and MOMA-2(1:25; Serotec,Oxford,UK),respectively.After incubation with the appropriate horseradish peroxidase(HRP)-conjugated secondary antibodies(1:100;Zhongshan Biological Technology,Wenzhou,China),the sections were incubated with 3',3'-diaminobenzidine and counterstained with hematoxylin.Sections reacted with non-immune IgG,secondary antibody only and no primary and secondary antibodies were used as negative controls.An automated image analysis system(Image-Pro Plus 5.0,Media Cybernetics,USA) was used for quantitative measurements.The positive staining area of macrophages,SMCs,lipids and collagen was quantified by computer-assisted color-gated measurement,and the ratio of positive staining area to the intimal area was calculated.The vulnerability index was calculated by the following formula:positive staining area of(macrophages +lipid)/positive staining area of(α-SMCs +collagen).7.Quantitative real-time RT-PCR analysisRNA was extracted with TriZol Reagent(Invitrogen) following the manufacturer's instruction.The mRNA levels of TLR1,TLR2,interleukin-6(IL-6), and monocyte chemoattractant protein-1(MCP-1) were quantified in in vitro RAW264.7 cells and in vivo fresh carotid plaque tissue by use of SYBR Green technology(Applied Biosystems).Quantitative values were obtained from the threshold cycle value(Ct).The housekeeping geneβ-actin was quantified as an internal RNA control.The "2-△△CT method" for comparing relative expression results was applied as described.8.Western blot analysisEqual amounts of protein from in vitro RAW264.7 cells and in vivo fresh carotid plaque tissue were separated on 14%SDS-PAGE and transferred to nitrocellulose membrane.Following blocking with 5%non-fat milk,the...
|
PDF Full Text Request