Studies On The Correlation Between Phosphorylated P27Kip1 On Thr157 And Human Hepatocellular Carcinoma | | Posted on:2011-11-17 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:P Li | Full Text:PDF | | GTID:1114360305973536 | Subject:Surgery | | Abstract/Summary: | PDF Full Text Request | | Objective1. Investigate the correlation of phosphorylate p27kip1 at T157 human hepatocellular carcinoma (HCC) and its clinicopathologic significance.2. Gene therapeutic approaches aimed at PI3K or the pharmacologic inhibitors of PI3K and transduction of mutant p27 (T157A) to down-regulate p-p27 Thr157 expression could be developed for the management of HCC, and preliminarily investigate the role of p27kip1 linked protein network during the process.3. Clone human p27kip1 gene, construct pEGFP-p27wt and pEGFP - p27Kip1 (T198A).Methods1. To evaluate the significance of p-p27kip1 Thr157 and PI3K pathway in hepatocellular carcinoma (HCC), we studied hepatocellular carcinomas along with corresponding nontumoral tissue and the HCC cell lines. Immunohistochemistry and western blot analysis suggested that p-p27 Thr157 was overexpressed in HCC, which was positively correlated with proliferation marker Ki-67. Correlation analysis was performed among immunohistochemistry assessed level of p-p27 Thr157, survival, and major clinical and pathological variables.2. The influence of the pharmacologic inhibitors of PI3K on the activity, cell cycle or apoptosis of hepatomacellular carcinoma, cells was detected by MTT colorimetry, Flow cytometry and Hochest staining. The expression of p27kip1 and p27kip1-related molecule was investigated by Western blot. The subcellular localization of p27kip1 and p27kip1-related molecule were detected by immunoflurescence.3. The full-length human p27 cDNA was amplified by PCR using two oligonucleotides and cloned into Bg1II-EcoRI sites of plasmid pEGFP-p27wt vector. Human cDNAs encoding a non-phosphorylable mutant with a threonine-to-alanine substitution at position 157[p27(T157A)] was introduced into the pEGFP-p27wt vector by using the overlap extension PCR technique. The primers for replacing Thr198 with Ala(198A) mutant were 5'CTCTCGAGGATGTCAAACGTGCGAGT 3'and 5'CGGAATTCTTTGACGTCTTCTGAGGCC 3'.For the transient expression experiments, p27 digests from the pEGFP-p27wt and pEGFP-p27(T157A) pcDNA3.1/myc-His expression vector. All p27 cDNA constructs were sequenced fully to ensure the absence of cloning artifacts.Results1. Immunohisto-chemistry and western blot analysis suggested that p-p27 Thr157 was overexpressed in HCC, which was positively correlated with proliferation marker Ki-67. Correlation analysis was performed among immunohistochemistry-assessed level of p-p27 Thr157, survival, and major clinical and pathological variables. Overexpressed p-p27 Thr157 was correlated with histological differentiation . Univariate analysis showed that p-p27 Thr157 and Ki-67 expression were correlated with tumor-specific survival. In a multivariate analysis, p-p27 Thr157 and Ki-67 protein 27 expression were proved to be an independent prognostic for HCC.2. The treatment of LY294002 and transduction of mutant p27 (T157A) could diminish the expression of p-p27 Thr157 protein and arrest cells growth. Our results suggested that p-p27 Thr157 protein expression may be a favorable independent poor prognostic parameter for HCC. Gene therapeutic approaches aimed at PI3K or the pharmacologic inhibitors of PI3K and transduction of mutant p27 (T157A) to down-regulate p-p27 Thr157 expression could be developed for the management of HCC.3. Clone human p27kip1 gene, construct pEGFP-p27wt and pEGFP - p27Kip1 (T198A).Conclusions1.Our results suggested that p-p27 Thr157 protein expression may be a favorable independent poor prognostic parameter for HCC.2. Gene therapeutic approaches aimed at PI3K or the pharmacologic inhibitors of PI3K and transduction of mutant p27kip1 (T157A) to down-regulate p-p27kip1 Thr157 expression could be developed for the management of HCC. | | Keywords/Search Tags: | Hepatocellular carcinoma, P27kip1 Cell cycle, Cell proliferation | PDF Full Text Request | Related items |
| |
|