Identification Of Gas1 As An Epirubicin Resistance–related Gene In Human Gastric Cancer Cells With A Partially Randomized SiRNA Library

Despite recent decreasing in incidence, gastric cancer remains the second most frequent cancer in the world and account for substantial morbidity and mortality worldwide. The outcome among patients with advanced gastric cancer is poor. Surgery combined with chemotherapy is the current treatment of choice.The combination of epirubicin, cisplatin and 5-fluorouracil (ECF) has been considered as one of the current standard chemotherapy regimes for gastric cancer. Accordingly, Epirubicin remains to be one of the most widely used first-line chemotherapy agents in gastric cancer, but like many other anticancer drugs, intrinsic and acquired resistance to epirubicin treatment has limited its clinical use. Our previous data showed doxorubicin, a structurally related chemotherapy agent to epirubicin, was ineffective in more than 60% of freshly isolated gastric cancer specimens. Unlike cisplatin and fluorouracil, whose resistance mechanisms in malignant tumors have been relatively well- characterized, the mechanisms of epirubicin resistance remain largely unknown. To date, few molecules have been correlated with the epirubicin resistance of gastric cancer. In previous work, we have identified multiple molecules related to multidrug resistance (MDR) through suppression subtractive hybridization and differential display-PCR. However, the mechanism of drug resistance is too complicated to be elucidated only by genotype-based screens due to the fact that numerous unrelated or non-essential molecules may mix with the real key regulators, therefore phenotype-based genome-wide functional screens might be ideal for functional annotation of both known and novel genes implicated in the drug resistance process.Since the discovery that 21- to 23-bp double stranded RNA (dsRNA) could mediate sequence-specific, post-transcriptional gene silencing of a homologous gene, RNA interference (RNAi) has been utilized as a powerful tool for inhibiting the expression of genes of interest. Genome-scale RNAi screens can reveal novel or unexpected pathways and gene families that can induce specific phenotypes when inhibited and simultaneously provide a large background set of genes for the determination of biological effects. Recently, RNAi screens in model organisms and human cells have successfully identified genes that modulate cell growth, apoptosis, chemoresistance, and chemosensitivity. This approach has been particularly successful for isolation of several genes that encode proteins involved in cancer-relevant pathways such as the p53 and NF-kB pathways, PI3K signaling, and RAS-dependent transformation. We hypothesized that siRNA (small interfering RNA) library screens could identify genes whose loss of function would confer decreased sensitivity to chemotherapy drugs. Identification of such genes could possibly provide targets for gene therapy that, either alone or in combination with conventional chemotherapeutic agents, might help to reverse drug resistance.Here, we constructed a partially randomized siRNA retrovirus library and performed RNAi screens in the presence of epirubicin to identify genes whose loss of function de-sensitized gastric cancer cells to chemotherapeutic-agent- induced cell death.【Objectives】1) Constructing a partially randomized siRNA retrovirus library. 2) Performing RNAi screens in the presence of epirubicin to identify genes whose loss of function de-sensitized gastric cancer cells to chemotherapeutic-agent-induced cell death. 3) Identifying GAS1 as an Epirubicin resistance–related gene in human gastric cancer cells with a partially randomized siRNA library.【Methods】1) siRNA retrovirus expression vector psiRNA-lib was constructed by molecular cloning technology and the effectiveness was confirmed by introducing Cdc2 siRNA sequence. The function of the vector was validated by Western Blot, MTT and fluorescence microscopy analysis.2) Based on rules suggested by Huesken et al, we synthesized the partially randomized siRNA library primer. The single-stranded library primers were annealed to extension primer and double stranded fragments were generated by primer extension. The double-stranded fragments were digested with SalI and ClaI and cloned into the same sites in plasmid psiRNA-lib-Cdc2, thus random siRNA plasmid library was established. 3) RNAi screens were performed in the presence of epirubicin to identify genes whose loss of function de-sensitized gastric cancer cells to chemotherapeutic-agent-induced cell death. In all, the resistant colonies were cultured and expanded for about 8 weeks before sequence identification and analysis. The screen was repeated 8 times totally. PCR amplification of the siRNA inserts was performed to recover functional siRNAs. BLAST was used to compare nucleotide sequences with human transcript databases and to calculate the statistical significance of matches. 4) Candidate genes were identified and validated by Quantitative RT-PCR,Western Blot,MTT,Flow Cytometry analysis etc.【Results】1) Construction and validation of the siRNA retrovirus expression vector pBMN-Z was cleaved by Bgl II and Sal? and further cloned into the same sites of pBMN-GFP to form pRetro-GFP. Second, the smaller BamHI/NheI fragments in the convergent opposing siRNA expression vector pHIPPY were removed and replaced by DNA duplexes formed by oligonucleotides targeting Cdc2. Thus, we created the siRNA expression vector pHIPPY-Cdc2 targeting Cdc2. Finally, the siRNA expression cassette including the Cdc2 sequence was generated in pHIPPY-Cdc2 by PCR. PCR was performed. The XhoI tagged result product was cloned into the SalI site in pRetro-GFP to form the siRNA retrovirus expression vector psiRNA-lib-Cdc2. Therefore, siRNA-lib was established from three independent constructs, which were from PBMN-Z, PBMN-GFP and pHIPPY. SGC7901-rec cells were generated by transfecting SGC7901 with the ecotropic receptor to improve retrovirus infection efficiency. SGC7901/siCdc2 and SGC7901/cont cells were established from SGC7901-rec cells infected with retrovirus harboring psiRNA-lib-Cdc2 and psiRNA-lib-cont, respectively. Cdc2 expression was downregulated in SGC7901/siCdc2 cells by Western blot analysis. The proliferation of SGC7901/siCdc2 cells was inhibited by MTT analysis. Fluorescence microscopy showed that the infection frequency was approximately 20% by analysis of GFP fluorescence. 2) Construction and validation of partially randomized siRNA retrovirus libraryAfter siRNA retrovirus expression vector psiRNA-lib was constructed and the effectiveness was confirmed by introducing Cdc2 siRNA sequence. We cloned the primer extension product of the synthesized 21 nt partially randomized sequence into the cloning site of psiRNA-lib. In order to increase the likelihood of obtaining a significant inhibition of gene expression, the 21 bp partially randomized siRNA library primer was synthesized based on guidelines suggested by Huesken et al. Thereafter, the 21 bp library primer was annealed with the extension primer, and primer extension was performed to form complementary DNA duplexes that were further ligated with psiRNA-lib. For each 10 cm Petri dish, as many as 8×103 clones were obtained when using 50 ng vectors at a ratio of 1: 10 relative to the siRNA insert. In total, ligation products were plated in 500 petri dishes and 4×106 clones were obtained finally.In order to validate the library, we isolated 20 independent clones for EcoR1 digestion and sequence information of the inserts was obtained. Of these, 18 constructs contained inserts of the appropriate size and all were unique, whereas one clone had no insert and one clone had a TTTTT termination sequence. Average G + C content was 41.1%. These results suggest that the library we constructed contained sufficient complexity for screening purposes. After library validation, we collected the pools of clones and extracted the plasmids.3) Screening of siRNAs that conferred resistance to EpirubicinTo validate the random siRNA screening approach, we developed a cell system to screen for EPI -resistant molecules in gastric cancer cells. PhoenixTM-Eco cells were transfected with 12μg siRNA library plasmid (equivalent to 106 plasmids) per 10 cm plate to generate the siRNA retrovirus library. In total, four plates of the virus library should then be used to infect four plates of SGC7901-rec cells and selected with 1.9μg/ml EPI to ensure relatively low plasmid/cell ratio (roughly 1:1) and enough coverage of library capacity. The first resistant pools of colonies were observed 2 weeks after retroviral transduction and, considering that some cells might survive whereas others might die gradually, we allowed all colonies to proliferate for 8 weeks under EPI selection pressure before further characterization. A plate of SGC7901-rec cells infected with the psiRNA-lib-cont virus was included as a parallel negative control to eliminate the possibility of acquired resistance due to prolonged culture with EPI. The screen was repeated 8 times to collect as many surviving clones as possible.Twelve clones were collected from total 32 plates in the presence of 1.9μg/ml EPI and no spontaneously resistant clones grew under these selective culture conditions. Subsequently, the genomic DNA of surviving cells was isolated individually and PCR was performed to amplify the siRNA expression cassettes; 12 siRNA sequences were obtained. To detect genes involved in drug resistance, we compared the sensitivities of SGC7901 cells transfected with psiRNA-lib plasmids harboring every candidate siRNA and psiRNA-lib-cont (SGC7901/cont) with different concentrations of EPI by MTT assay. Normalized by transfection efficiency, IC50 values of SGC7901 cells transfected with all siRNAs were higher than those of SGC7901/cont cells, with siRNA 001 (4.3-fold) and siRNA 003 (3.9-fold) the most significant, indicating these siRNAs might suppress genes involved in EPI resistance. BLAST was used to compare nucleotide sequences with human transcript databases and to calculate the statistical significance of matches. Of the 12 siRNA sequences obtained, siRNA 001 and siRNA 003 produced the most significant alignments, whereas the other 10 siRNAs failed to target any transcripts in the human genome. The sense strand of siRNA 001 (TTCATTTCCATGAAGCCACCG) has 95% homology to site 204-224 (TTCATTTCCAGGAAGCCACCG) of the human growth arrest-specific 1 (GAS1) (NM₀02048.1) transcript, with only one nucleotide mismatch (T at position 11 instead of G). The sense strand of siRNA 003 (TTTAACTGTATTATTTGGCAG) has 95% homology to site 5221-5241 (TTTAACTGTAGTATTTGGCAG) of the phosphatase and tensin homolog (PTEN) (NM₀00314.4) transcript, with one nucleotide mismatch (T at position 11 instead of G). These two genes are likely to be the target genes for our isolated clones.4) Identification of GAS1 as an Epirubicin Resistance–Related GeneTo determine whether GAS1 was involved in chemoresistance of gastric cancer, we firstly examined the effect of GAS1 on the sensitivities of different gastric cell lines with varying levels of GAS1 expression to various structurally unrelated anticancer agents. AGS and MKN28, which showed the lowest background expression of GAS1 among the four cell lines, were chosen for studies by up-regulating GAS1 expression. Cells were transfected with pcDNA3-GAS1 plasmid 48 h before treatment with 0.08μg/ml epirubicin (EPI), 2.5μg/ml 5-flurouracil (5-FU) or 0.4μg/ml cisplatin (CDDP) respectively. Cells were then cultured for an additional 48 h and cell viability was determined by MTT assay. We observed enhanced cell death after chemotherapeutic agents in cells transfected with pcDNA3-GAS1, as compared with those treated with low dose chemotherapeutic agents alone, which displayed little effect on cell death. To further determine the role of GAS1 down-regulation in MDR, we tested whether GAS1 down-regulation was able to protect against death induced by EPI, 5-FU and CDDP. We transfected SGC7901, MKN45, MKN28 and AGS cells with psiRNA-lib-GAS1 separately to inhibit GAS1 expression. Cells were cultured for 48 h before treated with low dose EPI, 5-FU and CDDP respectively. We observed enhanced cell survival after chemotherapy in cells transfected with GAS1 siRNA plasmid and this increase was correlated with GAS1 expression. It was also noted that GAS1 down-regulation had little effect on the protection against drug-induced death in AGS cells, which showed little endogenous expression of GAS1, indicating this effect was specific to GAS1 inhibition.We further examined GAS1 expression in two drug-resistant cell lines we established previously, SGC7901/ADR and SGC7901/ VCR, which also display cross-resistance to various drugs including EPI. It was found that compared with SGC7901/cont cells, GAS1 was significantly down-regulated in both SGC7901/ADR (>10-fold, p<0.05) and SGC7901/ADR (>10-fold, p<0.05), and up-regulating GAS1 expression by pcDNA3-GAS1 transfection could partially reverse EPI resistance mediated by GAS1 inhibition when compared with controls.We identified the apoptosis-promoting role of GAS1 in regulating chemosensitivity of gastric cancer cells. FACS detection of annexin V showed that the proportion of apoptotic SGC7901/siGAS1 cells was significantly decreased (>2-fold) when compared with the proportion observed in SGC7901/cont cells. This finding suggests that GAS1 could inhibit EPI-induced apoptosis in gastric cancer cells. Subsequently, two important molecules in apoptosis, Bcl-2 and Bax, were investigated for possible involvement. Western blotting indicated that inhibition of GAS1 could up-regulate Bcl-2 without affecting the expression level of Bax. Furthermore, when SGC7901 cells were exposed to either EPI 5-FU and CDDP, inhibition of Bcl-2 expression by siRNA transfection could significantly decrease the effect of GAS1 inhibition on the survival of cells. However, decreased expression of GAS1 per se promotes cell proliferation, we can not exclude that the enhanced proliferation might also contribute the resistant phenotype.We attempted to determine whether GAS1 affects intracellular drug accumulation. The fluorescence intensity of intracellular EPI was determined by flow cytometry. SGC7901/siGAS1 cells showed significantly decreased fluorescence intensity compared with SGC7901/cont cells, indicating that GAS1 inhibition regulated the active transportation of drugs.We further explored whether GAS1 inhibition could affect the expression of P-gp and the other two members of the ABC transporter family, MRP-1 and BCRP. Western blotting revealed that P-gp and BCRP but not MRP-1 was up-regulated by GAS1 inhibition in gastric cancer cell lines. AGS cells were not included in this study due to relatively low expression of GAS1. To determine whether inhibition of transporter expression affects GAS1 down-regulation- induced drug resistance, we performed MTT assay in which expression of P-gp, BCRP, or both were inhibited by siRNA transfection. It was indicated that inhibition of transporter expression could partially reverse EPI resistant phenotype mediated by GAS1 inhibition when compared with controls, with the greatest effect observed in cells in which expression of P-gp and BCRP were both inhibited. However, Cells with GAS1 inhibition still had a weak survival advantage over control cells, even in the presence of P-gp and BCRP siRNAs. Furthermore, we examined whether resistance of SGC7901/siGAS1 cells to P-gp substrates EPI, ADR (Adriamycin) and VCR (Vincristine) could be modulated by verapamil, a P-gp inhibitor and chemosensitizer. MTT assay showed that verapamil could partially reverse the EPI, ADR and VCR resistance by GAS1 down-regulation, whereas it exerted little effect on GAS1 down-regulation mediated 5-FU and CDDP resistance, which were non-P-gp substrates. P-gp knockdown by P-pg siRNA transfection also exerted no reverse effect on 5-FU and CDDP resistance mediated by GAS1 inhibition. Interestingly, although there is little report concerning BCRP mediated 5-Fu and CDDP resistance, our findings suggested knockdown of BCRP expression by siRNA transfection could partially reverse 5-FU resistance mediated by GAS1 inhibition when compared with controls in SGC7901 cells, however, no influence on CDDP resistant phenotype was observed by BCRP knockdown analysis. These findings indicate that GAS1 down-regulation promotes MDR partially by increasing drug efflux by ABC transporters.【Conclusion】We constructed a partially randomized siRNA retrovirus library that was used to successfully identify GAS1 as an epirubicin resistance related gene in gastric cancer cells. This practical platform could provide a useful tool for the investigation of novel or unexpected pathways and gene families related to a specific phenotype in a large number of cell types and a broad variety of organisms.