Mechanisms Of HGF/c-Met On EPCs Proliferation And Homing To The Injuryed Vascular

1. Background and Objective:Endothelial damage is a major contributing factor to atherosclerosis and post-angioplasty restenosis. Although endothelial cell (EC) repair mechanisms are considered to be mediated by adjacent mature endothelial cells, vascular endothelial cells only regenerate moderately in physiological conditions. If the endothelium persists under risk factors, local endothelial repair is incomplete.More recently, circulating, bone marrow or spleen-derived endothelial progenitor cells (EPCs) have been found to present several advantages for endothelial regeneration after vascular injury. EPCs can be mobilized to the sites of injury and are amenable to ex vivo genetic engineering with viral vectors, making them ideal vehicles for delivery of therapeutic genes to sites of injury. Although rescent studies identified that automobilized EPCs can be involved in the progress of revasculation, the endothelium repair is ineffective. The reasonable explanation is that the founction of automobilized EPCs is defective and the number of EPCs homing to the injury site is insufficient. Thus, understanding the regulation mechanism of EPCs and how to improve the efficience of the EPCs homing is becoming the hot spot.Hepatocyte growth factor (HGF), initially identified as a powerful stimulatory agent for primary cultured hepatocytes, is a multifunctional cytokine that regulates growth, motility, and morphogenesis of various cell types. Serum HGF levels are elevated in response to hypertension, acute myocardial infarction, diabetes mellitus with hypertensive complications, peripheral arterial occlusive diseases and carotid atherosclerosis . Several lines of evidence have implied that HGF is expressed locally in the arterial wall after injury and promotes the survival and proliferation of EPCs and ECs. Furthermore, HGF has also been demonstrated to promote the proliferation and survival of human CD34+ hematopoietic progenitors and induce angiogenesis in injured lungs through mobilizing EPCs from bone marrow, suggesting that HGF is involved in arterial repair and atherogenesis.HGF promotes cell growth by stimulating the tyrosine kinase activity of the HGF-specific receptor encoded by the c-Met proto-oncogene. Following HGF activation of c-Met, phospholipase c-γ(PLC-γ) is phosphorylated. Phosphorylation of PLC-γresults in inositol triphosphate (IP3) mediated Ca2+ store depletion and subsequent Ca2+ influx across the plasma membrane (PM). Endoplasmic reticulum (ER) Ca2+ depletion activates PM-localized Ca2+ influx channels known as store-operated Ca2+ channels (SOCCs). Ca2+ signaling through SOCCs activates the expression of specific genes necessary for the regulation of cell growth and cell division.SOCC activation relies exclusively on store depletion. Thus, the ER must communicate with SOCCs within the plasma to signal Ca2+ store depletion. After years of research, a membrane-spanning protein named stromal interaction molecule 1 (STIM1) was revealed as the key molecule required for the activation of SOCCs. Whereas STIM1 is likely the"sensor"of Ca2+ within ER Ca2+ stores and disperses on the ER membrane in quiescence, Ca2+ store depletion results in the rapid translocation of STIM1 into puncta close to the PM. This relocalization of the protein is thought to act as the store depletion signal to the SOCCs in the PM, subsequently leading to the opening of SOCCs.However, it is not known whether STIM1 is involved in HGF-induced EPC growth, which is an important event for the vascular repair process, and whether HGF/c-Met can accelerate the re-endothelialization after ballon injury in rat model. Therefore, in this study, we siRNAed STIM1 and overexpressed c-Met to study the mechanism and effects of STIM1 and HGF/c-Met on EPC proliferation and recovery of balloon-injured artery.2. Methods:2.1 EPCs isolation and characterizationTotal bone marrow or spleen-derived mononuclear cells (MNCs) were isolated by density gradient centrifugation (Lymphoprep 1.083) at 400×g for 20 min. After three washes, cells were plated on cell culture flasks and propagated in low glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS), 10 ng/ml recombinant human vascular endothelial growth factor (VEGF), 100 IU/mL penicillin, and 100μg/mL streptomycin. Cells were maintained at 37°C in a humidified atmosphere (95% air and 5% CO2) condition. Twenty-four hours later, nonadherent cells were transferred to a new flask to remove adherent hematopoietic cells and mature endothelial cells. Media were refreshed every 3 days. For characterization, differentiating cells were incubated with acLDL-Dil (10 mg/ml) for 4 h, fixed with 4% paraformaldehyde and then incubated with FITC-labeled lectin (UEA-1) for 1 h. Additionally, flow cytometry (FACS) analysis was performed using antibodies against rat CD133, CD34, VEGFR-2 and the corresponding isotype control antibodies.2.2 Cell proliferation studiesEPCs were trypsinized and replaced into fibronectin-coated 96-well plates (1×105 cells/mL). Mitochondrial dehydrogenase activity was measured by the cleavage of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma, St. Louis, MO) to purple formazan as an index of cell viability.2.3 RNA isolation and quantitative real-time polymerase chain reaction (RT-PCR) Total RNA was extracted from EPCs using the TRIzol reagent. cDNA was synthesized using oligo (dT) and M-MLV reverse transcriptase according to the manufacturer's protocol. For quantitative RT-PCR analyses, the ABI PRISM 7000 Sequence Detection System and SYBR Green PCR Master Mix were used.2.4 Western blot analysisAfter treatment, cells were lysed in lysis buffer. Protein concentrations of cell extracts were measured using the Bradford method. Equal amounts of protein (100μg) were separated by SDS-PAGE (10% polyacrylamide gel) and electrophoretically transferred onto a polyvinylidene fluoride membrane. The membranes were blocked with 5% nonfat milk solution in TBS with 0.5% Tween- 20 and incubated in STIM1 primary antibody purchased from BD, at 4 ?C for 4 h. Finally, membranes were incubated with anti-rabbit horseradish peroxidase-conjugated IgG for 1 h. Protein bands were visualized by chemiluminescent detection and quantified by a gel image analysis system. Anti-GAPDH monoclonal antibody was used to test for equal protein loading.2.5 Fluorescence Cell Imaging EPCs placed in a special chamber were loaded with the Ca2+ indicator Fluo-3/AM and continuously cultured at 37 ?C for 30 min in a 5% CO2 incubator. After loading with the fluorescence probe, changes in intracellular Ca2+ infux ([Ca2+]i) in individual cells were measured using a digital imaging system equipped with a laser confocal scanning microscope with an excitation wavelength of 488 nm.2.6 Knockdown of STIM1 by siRNAAd-si/STIM1 and non-silencing control (NSC) were a gift from Dr. Guo. The selected siRNA duplex sequences specifically targeted rat STIM1 (rSTIM1, NM₀01108496), and showed no homology to any other sequences by a blast search. The two sequences used in this study are (i) Start nucleotide 935, GCAUGGAAGGCAUCAGAAGUGUAUA; and (ii) start nucleotide 970, GGAUGAGGUGAUACAGUGGCUGAUU. A non-silencing control (NSC) sequence was designed according to the sequence of a negative control.2.7 Construction of recombinant adenoviral vectorsAdenoviral vector expressing c-Met was generated using the AdEasy system. Briefly, full-length rat C-Met cDNA was buyed from Baosai company. The shuttle vector was used to generate recombinant adenoviruses according to the manufacturer's protocol. An adenovirus encoding green fluorescent protein (GFP; Ad-GFP) was used as control.2.8 Vascular injury modelTo evaluate the role of HGF/Met in vascular repair in vivo, we used balloon-injured rat carotid artery model. Evans Blue dye was administered to evaluate reendothelialization after 10 days injury, and the neointimal formation was assessed at 21 days following vascular injury.3. Results:3.1 EPCs isolation and characterizationFreshly plated bone and spleen derived MNCs possessed a rounded shape. After 3 to 5 days in culture, adherent cells formed cluster- or cord-like structures. The number of EPCs continually increased and the cells elongated to possess a spindle shape over the next 7 days. EPC colony-forming units became obvious after 10 days in culture. EPCs cultured 14 days formed tubular-like appearance and grew to confluence with a cobblestone shape at 21 days. For further characterization, after 7 days in culture, attached cells were analyzed with immunofluorescence and FACS. Cells took up Dil-Ac-LDL, bound lectin, and expressed endothelial/stem cell markers, including CD133, CD34 and VEGFR-2 were EPCs.3.2 Effects of HGF on EPC proliferationThe effect of HGF on EPC proliferation was examined using the MTT assay 48 h after exposure to different quantities of HGF (range 2-20 ng/ml). The proliferation effect was strongly dose-dependent and increased in HGF-treated EPCs but not in control cells. Thus, our results suggest that HGF accelerates EPC proliferation. Because the maximum proliferation effect occurred even at 10 ng/ml, we used 10 ng/ml HGF as the proliferation stimulus in subsequent experiments.3.3 Increased SOCE in HGF-treated EPCsIn order to test whether SOCE plays a role in HGF-induced EPC proliferation, the long-term effect of HGF on SOCCs activation in EPCs was assessed after treated with HGF for 48 h. Changes in [Ca2+]i in individual cells were estimated and compared before and after store depletion between control and HGF-treated cells using fluorescence microscopy. Ca2+ stores were initially depleted by inhibition of ER Ca-ATPase activity with 2μM thapsigargin (TG) in the absence of extracellular Ca2+. After addition of TG, transient cytosolic Ca2+ release from the ER occurred, confirming the emptying of ER Ca2+ stores. Following restoration of extracellular Ca2+ (CaCl2; 5 mM), a rapid increase of Ca2+ influx was observed, which was due to SOCCs activation. The maximum amplitude in [Ca2+]i caused by SOCE was greatly increased in HGF-treated EPCs compared to control cells (140 % versus control).To assess further the dependence of SOCE on HGF-induced EPC proliferation, we investigated the effects of SOCC inhibitors on EPC proliferation. As shown in Fig. 3b, this inhibition was evaluated by the MTT assay after 12 h of pre-incubation with SOCC inhibitors (2-APB;100μM and BTP-2;10μM). Both BTP-2 and 2-APB, compared to the HGF treated group, inhibited the proliferation response significantly. These common effects clearly suggested that SOCE is needed for HGF-induced EPCs proliferation.3.4 Expression of STIM1 in HGF-treated EPCsTo test whether HGF affects the expression of STIM1, quantitative real-time PCR and western blotting were performed after HGF stimulation. STIM1 mRNA levels were very low at resting states, but greatly increased 12 h after HGF treatment and reached a maximum of 4-fold greater than baseline levels after 24 h of HGF treatment. Western blot analysis indicated that the STIM1 protein level increased significantly after 24 and 48 h treatment with HGF. These results indicated that STIM1 expression is upregulated in EPCs after HGF stimulation.3.5 Knockdown of STIM1 expression attenuates SOCE and HGF-induced EPC proliferationTo determine whether endogenous STIM1 affects SOCE and HGF-induced EPC proliferation, we delivered adenovirus constructs expressing si/rSTIM1 to knockdown STIM1 protein levels. Cells treated with HGF but transfected with a random sequence were defined as the non-silencing group (nsRNA) and used as a control to monitor non-sequence-specific effects. Forty-eight hours after transfection, the level of STIM1 protein decreased by 76% compared to the control. HGF stimulation for 48 h increased the STIM1 protein level to 340% compared to the control group. In the siRNA+HGF group, STIM1 protein expression decreased about by 81% compare to the HGF group. Furthermore, When we measured the effect of an siRNA targeted against rSTIM1 on SOCE, the maximum increase in [Ca2+]i caused by SOCE robustly decreased in siRNA-treated EPCs compared to the nsRNA group. Cell proferation measured by MTT in the siRNA group was significantly lower compared to the nsRNA group. Taken together, these results indicate that STIM1 molecules play a key role in the proliferation response of EPCs.3.6 Effect of Ad-Met on vascular reendothelializationEvans Blue dye was administered to evaluate reendothelialization after balloon injury. Nonendothelialized lesions were marked blue at injured vessels, whereas the reendothelialized area appeared white at uninjured vessels. The reendothelialized area in the Ad-Met-infected EPCs transplantation group was significantly larger than that in Ad-GFP-infected EPCs transplantation and control groups.3.7 Effect of Ad-Met on neointimal formationA marked decrease in the neointimal area and I/M ratio was shown in Ad-Met–EPCs treated rats compared with that of Ad-GFP-EPCs treated and control group at day 21.4. Conclusions:4.1 HGF accelerated EPC proliferation.4.2 Store-operated Ca2+ entry (SOCE) was elevated in HGF-treated EPCs.4.3 STIM1 mRNA and protein expression levels were increased in response to HGF stimulation.4.4 Knockdown of STMI1 decreased SOCE and prevented HGF-induced EPC proliferation.4.5 Ad-Met-infected EPCs promoted reendothelialization and inhibited neointimal formation than those in Ad-GFP-infected EPCs transplantation and control groups.