Screening And Function Analysis Of Porcine Circovirus Type2(PCV2) Cap Interaction Proteins And Anti-cap Nanobodies

PCV2, a covalently closed circular chain of negative single DNA strands virus, is knownone of the smallest animal viruses and the causative pathogen of the postweaningmultisystemic wasting syndrome (PMWS), which causes significant economic loss to theswine industry worldwide. So far, PCV2replication and pathogenic mechanism have not beenfully understood. PCV2can be highly proliferated in fetal porcine retina epithelium cells(PD3) and induce cytopathic effect (CPE). Therefore, PD3cell line is an ideal cell model tounderstand PCV2pathogenic mechanism.A new type of antibody is now known to be present in the Camelidae family. Theseantibodies do not contain a light chain and also lack CH1constant heavy domain, also knownas heavy chain-only antibodies(HcAbs). Currently, the genetic engineered camel variabledomain of heavy chain of heavy-chain antibody(VHH) is the smallest antibody format withintact antigenbinding activity, a molecular weight of approximately15kDa (1/10of theconventional antibody),4nm in length and2.5nm in height, so referred to as nanobody(Nb).Compared with conventional antibody, nanobody has some unique properties: the molecularweight is small, easy to express in any expression system; high solubility and stability; recognizestructures inaccessible for conventional antibodies; high affinity and tissue penetration.Therefore, nanobody is widely used in the fields of antivirus, drug residues detection andanti-tumor therapeutic. To date, the widely used method for engineering antibody screen wasbased on phage surface display. However, this method is unable to use for protein withcomplex structure and hardly to expressed(such as PCV2Cap protein), or for intra-cellularproteins.This study aims to understand the interaction between PCV2and host cell protein usingPD3cell model to explore PCV2pathogenesis, and select corresponding nanobody targetingPCV2Cap protein for PCV2diagnosis and Cap function study. The main results are as below:1. Establish a novel method to construct Camelus Bactrianus-derived single-chainantibody library based on Matchmaker Gold Yeast Two-Hybrid System (Clontech). Thetransformation efficiency and titer of the VHH Y2H library were7.26×106cfu/3μg and1.97×109cfu/mL, respectively. The percentage of library insertion diversity was more than95%, which met the demand for Y2H library screening. The system provided a new technology to establish a high-throughput nanobody screening platform.2. Using as an example the porcine circovirus type2(PCV2) Cap protein as bait,21positive Cap-specific VHH sequences were screened.9VHH fragments from21positivesequences were randomly selected for expression by pCold DNA I system. The recombinantplasmids were transformed into E. Coli BL21(DE3) and grown at15℃by inducing0.4mMisopropyl-D-thiogalactopyranoside (IPTG) for10h. Cap gene was cloned into the pMAL-c2Xvector for fusion expression with MBP tag in E. coli Rosetta, and grown at37℃byinducing0.3mM IPTG for3h. Among these VHH sequences,7of9randomly selectedclones were strongly positive as indicated by enzyme-linked immunosorbent assay (ELISA),either using PCV2viral lysis or purified Cap protein as coated antigen. Additionally, theimmunocytochemistry and immunofluorescence results further indicated that the screenedVHHs could specifically detected PCV2infected cells.3. The TCID50reach to10-6.4after PD3cells infected with PCV2. During the indirectimmunofluorescence experiments, we found that36h after infection the fluorescence signalwas most and strongest, cells appeared to obvious cytopathic effect (CPE) at48h. To screenthe interaction protein of PCV2Cap in PD3cells, we constructed PD3cells cDNA libraryaccording to yeast two hybrid system. The titer of cDNA library was5.00×108cfu/mL withthe inserted fragments about0.4-2.0kb, and the recombination rate was above95%. By usingCap as bait, six cellular proteins were found to interact with Cap (C1QBP, CK2α, FASTK,Tubulin2A, ZNF622and GTFIIF) after three rounds of screening and validation in yeast.Among them, CK2α, FASTK, ZNF622and GTFIIF were firstly reported, while C1QBP playan important function in the process of immune response.4. Full-length genome sequence of Swine C1QBP, encoding for846bp, was submitted toGenBank (GenBank ID: JQ087873). The biological interactions between Cap and C1QBPwere confirmed by co-immunoprecipitation and immunofluorescence microscopy assays.C1QBP was co-located with Cap, a most dramatic concentration of both proteins in thecytoplasm area and the plasma membrane around the nucleus was the consequence. Alsothrough the qRT-PCR and Western blotting assays, the C1QBP expression in PD3cells wasup-reglated after PCV2infection (P <0.05).5. The effective shRNA against Swine C1QBP gene was selected, and the lentiviralvector for RNAi with Puro and Neo double antibiotics resistance gene was constructed. Thetiter of packaged lentivirus expression, Swine C1QBP RNAi reached to107cfu/ml. Whenlentivirus infected PD3cells, the transduction efficiency was up to40%. Through theqRT-PCR and Western blotting to detect the interference efficiency, the results demonstratedthat the interference effect of19bp siRNA sequences (GAGCACCAGGAGTACATTA) was better than21bp siRNA sequences (GCTTATATGACCACCTAATGG).6. Knockdown the C1QBP gene can shorten the PD3cell CPE appearing time afterinfected by PCV2, and the virus titer increased as well. On the contrary, overexpression ofC1QBP can decrease the virus titer. These results demonstrated that C1QBP could inhibitproliferation of PCV2. By using qRT-PCR and Western blotting assays to compare theC1QBP expression between PD3and PK15cells, the results showed that C1QBP was highlyexpressed in PK15cells than PD3cell in both mRNA and protein level (P <0.05). Thus, wesuggested C1QBP could be a negative regulatory factor for PCV2infection and CPEappearance.In conclusion, this study first used yeast two hybrid technology to construct fetal porcineretina epithelium cells cDNA library and Camelus Bactrianus-derived single-chain antibodyimmune library, and successfully obtained the host proteins and nanobodies which caninteract with PCV2Cap protein. These results would be helpful to reveal the mechanism ofPCV2caused PD3cell lesions in the further study.