Font Size: a A A

Insights Of The H5N1Influenza High Pathogenicity And Pandemic Infectivity By Bioinformatics Methods

Posted on:2009-09-17Degree:DoctorType:Dissertation
Country:ChinaCandidate:X L GuoFull Text:PDF
GTID:1224330392961874Subject:Biomedical engineering
Abstract/Summary:
Highly pathogenic avian influenza viruses (AIV) of the H5N1subtype has attractedinternational attentions. The World Organization for Animal Health (OIE) reported thatfrom January2004to April2007, there were more than5200H5N1outbreaks in44countries in Asia, Europe and Africa. A total of322human cases of the H5N1infectionwere confirmed in12countries,195patients were fatal, according to the World HealthOrganization (WHO).With the increasing scale of the H5N1outbreaks and the increasing number ofinfected patients, the whole world is worried about whether highly pathogenic H5N1viruswould trigger a more serious epidemic than the SARS. To cause a global influenzapandemic, the virus needs3properties:(1) substantial antigenic novelty;(2) ability toinfect people and cause serious diseases; and (3) efficient person-to-person transmission.Investigations showed that the H5N1virus clearly had the first2properties, i.e. a newhighly pathogenic subtype, but no substantial evidence of efficient human-to-humantransmission was noted. In view of these two properties, this thesis studied the pathogenicmechanism of the H5N1and the gene features of human-to-human transmission.Hemagglutinin (HA) precursor HA0cleaved into two subunits, HA1and HA2, is anessential step in the viral infection. The cleavage activation of HA0can be achieved bytwo classes of proteases, i.e. trypsin-like proteases and alkaline proteases. The distributionof these proteases in the host and the sequence of the HA cleavage site appear to be theprime determinant for the virus pathogenicity.In this thesis, cellular automata (CA), homology modeling, docking methods wereused to study the mechanism and evolution of the high pathogenicity of the H5N1from interactions between HA cleavage site and proteases, and some exciting results wereobtained as follows:1. A unique feature gene segment of H5N1-H5was found, whose translation waslocated in the cleavage site of HA. The result verified that the H5N1-H5had a unique,special cleavage site, and also provided a new method for rapid detection of H5N1.H5N1-H5gene sequences were visualized using cellular automata, and somestructural characteristic was found in the H5N1-H5CA image. The structuralcharacteristic was generated by a feature gene segment (FGS) which was a30bps genesegment mainly consisting of nucleotides ‘A’ and ‘G’ near1012bp position. Most FGSwere ‘CAAAGAGAGAGAAGAAGAAAAAAGAGAGGA’; others were segments with1-5bps mutations. When translated into amino acids the FGS converted into a segment ofmainly basic amino acids. This segment was located in the cleavage site loop of HA0,which was the determinant of the high pathogenicity of the H5N1.2.21mutants of the H5N1-H5cleavage site were classified into six types accordingto the number of basic residues. Statistical analyses of six mutant types were made withrespect to when and where the H5N1viruses were found. It was found that the proportionof mutated cleavage site increased year by year. The number of basic residues decreasedfrom7to6. Most mutants were in Mainland China and Hong Kong, while few in Thailand,Vietnam and Indonesia, and12mutants were originated from Mainland China and HongKong.3. The3D structure was reconstructed with the homology modeling for H5N1-H5with the crystal structure of H1N1-H1as the template. The cleavage site loop of H5N1-H5was extended further than that of H1N1-H1, and the molecular surface showed that it wasmore exposed to the potential proteases than that of H1N1-H1.4. Interactions between different HA cleavage sites and proteases were studied fromeach subsite to reveal the pathogenic mechanism at molecular level, and subsites P1, P2, P4and P6were found contributive to the high pathogenicity of the H5N1virus.Molecular modeling tools were utilized to study the coupled model systems of theproteases, i.e., nonapeptide ‘RERRRKKR↓G’ and hexapeptide ‘SIQSR↓G’ from thehighly pathogenic H5N1-H5and the lowly pathogenic H1N1-H1cleavage sites weredocking to trypsin and furin, respectively. The pathogenic mechanism was explained fromsubstrate selectivity of different proteases. It was observed through the docking studies that trypsin got most of its selectivity due to the interactions with P1and little interactionswith other positions. The S1pocket accommodated long side chains of the basic aminoacid with positive charges. An analysis of binding energies indicated that furin got most ofits selectivity due to the interactions with P1, P2, P4and P6. The active site of furin rich inacidic residues and subsites S1, S2, S3, S4, S5, S6and S8were all in favor for basic residues.The S1, S4and S6pocket were specifically designed to accommodate arginine, with lysinesubstitution fitting less well in different degrees. So trypsin was able to recognize andcleave both the highly pathogenic and lowly pathogenic hemagglutinin, while furin couldonly cleave the highly pathogenic hemagglutinin.5. Different mutants of H5N1-H5cleavage site were docking to furin to study theevolution of the H5N1pathogenicity. The binding free energies by docking the currentdominant mutants ‘GERRRKKRG’,‘RESRRKKRG’ and ‘RERRRKRG’ to furin werelittle weaker than the perfect ‘RERRRKKRG’, having little impact on the highpathogenicity of the virus. If more basic residues were mutated, the binding free energieswould weaken more than10kcal/mol, and reduce the pathogenicity of the virus.Three pandemic influenza viruses emerged in the20th century: the1918H1N1virus,the1957H2N2virus and the1968H3N2virus. Five segments including PA, PB2, NP, MPand NS in both1957and1968viruses came of1918H1N1virus. They were thought to becorrelated to some pandemic features.In this work,33pandemic sites, i.e. the199th,475th,567th,627thsites of PB2, the55th,100th,241st,312th,382nd,400th,552nd,716thsites of PA, the16th,100th,136th,283rd,313th,357thsites of NP, the121stsite of M1, the14th,16th,20th,78th,86thsites of M2and the21st,22nd,84th,114th,171st,196th,215th,227th,229thsites of NS1, were identified by scanningamino acid sequences of three pandemic influenza viruses. The H5N1viruses haddifferent residues on most of these sites, which was coincident to the current status of noefficient human-to-human transmission of H5N1influenza. The human H1N1and H3N2viruses had been losing some pandemic residues during their evolution, while humanH2N2virus still remains the pandemic residues. If reassortment between avian H5N1virus and human H2N2virus or among three subtype viruses happened, and the newinfluenza virus inherited the pandemic genetic feature at PB2, PA, NP, MP and NS fromhuman viruses and the high pathogenicity of HA from H5N1virus, then the next pandemicinfluenza would emerge. The reassortment would probably happen in “gene mixing vessel” pigs. Chinese rural ecological environment provided the perfect condition forreassortment. We should pay more attention to these residues, especially those in givendomains.
Keywords/Search Tags:H5N1, hemagglutinin, high pathogenicity, cleavage site, cleavage mechanism, trypsin, furin, binding free energy, pandemic geneticfeatures, reassortment
Related items