| BACKGROUNDThere are currently two conflicting views that attempt to explain tumor formation. The classical stochastic model suggests that every cell within a tumor is a potential tumor-initiator, but that entry into the cell cycle is governed by a low probability of stochastic mutations. According to this model, it would be impossible to tell which cell initiated the tumor since each cell has an equal ability to be malignant. Cancer stem cell hypothesis have been proposed nearly for100years. However, the first conclusive evidence for cancer stem cells (CSCs) was published in1997in Nature Medicine. This new hypothesis postulates that cancer only arises from a small subpopulation of cells defined as cancer stem cells or tumor-initiating cells (TICs) which also are supposed to respond for tumor progression, metastasis, resistance to therapy, and subsequent tumor recurrence. Increasing evidence has been obtained, thus CSCs were considered as one of the most interesting discoveries. The existence of CSCs is based on important evidence that these cells have tumorigenic potential when transplanted into NOD/SCID or other highly immunocompromised mice. However, the existence of CSCs is still a subject of debate within medical research, because many studies have not been successful in discovering the similarities and differences between normal tissue stem cells and cancer stem cells. To explore whether one single cancer cell has ability to eventually develop into a tumor is critical to confirm the validity of this hypothesis. However, previous studies hardly use one-single-cell process to confirm this hypothesis. If cancer stem cell is only a wrong hypothesis, then why a large body of evidence was obtained in previous researches? We should look at the motives behind all this persuasion.Purpose1) To assess the frequencies of tumorigenic cells in breast cancer cells by clonal-expanded and tumor-forming analyses.2) To explore the role of the epithelial-mesenchymal-transition (EMT) in the enrichment of CSCs in mammosphere culture system.3) To explore the potential contribution of EMT to special biological behaviors of CSCs.4) To explore the potential mechanism of the enhanced tumorigenicities of CSCs.5) To evaluate the association of CSCs with cells with mesenchymal-like phenotypein clinical samples.Materials and Methods1) Flow cytometric analysis Cells were trypsinized, suspended into single-cell mixtures, washed with phosphate buffered saline (PBS), and incubated on ice for30min with monoclonal antibodies specifc for human cell surface markers CD44-FITC (eBioscience, San Diego, CA, USA) or CD24-PE (eBioscience). In negative control experiments, cells were incubated with fuo-rescence-labeled isotype-matched pre-immune IgG instead. Cells were washed and analyzed using a fow cytometer (BD FACS Aria, San Jose, CA, USA)2) One-single-cell clonal-expanded and tumor-forming analyses (OCTAs) One-single-cell suspension was seeded into96-well plates, and cultured in serum-containing medium. Wells containing only one cell were visually confirmed under a microscope and marked, and wells with no cells or more than one cell were excluded. After cell clones were formed, the clones were transferred to24-well plates and expanded in fresh serum-containing medium. Cells were similarly transferred into6-well plates when adherent cells spreaded over the bottom of well. Finally, cells were transferred to10cm x10cm Petri dish and further expanded. The total of1x107expanded clonal cells was then injected in the flank region of4-week old female BALA/C-nude mice or NOD/SCID mice.3) Tumorigenic abilities of breast cancer cells by3D culture Coat prechilled culture surface with a thin layer of matrigel (BD Biosciences, San Jose, CA, USA) by slowly pipetting60-100μL of matrigel directly onto culture surface, spreading evenly with a pipette tip and incubating for30min at37℃to allow the Matrigel to gel. Cells were mixed with complete culture medium of5%matrigel and then seeded into precoated plates. Cells were cultured in37℃and5%CO2condition.4) Mammosphere culture Single-cell suspensions of MCF-7cells were suspended at a density of50,000cells per milliliter in serum-free Dulbecco’s modified Eagle’s medium/F-12containing5μg/mL bovine insulin(Sigma),0.4%bovine serum albumin (BSA, Sigma),2%B27(Invitrogen),20ng/mL basic fibroblast growth factor (bFGF, Peprotech) and10ng/mL epidermal growth factor (EGF, Peprotech), and culture in37℃and5%CO2condition.5) Breast cancer cells were cultured in media with EMT-induced cytokines For EMT induction, non-CSCs were cultured in media with50ng/ml IL-6,20ng/ml EGF and20ng/ml bFGF, or lOng/ml TGF-β1in37℃and5%CO2condition.6) Assessment of proliferation and doxorubicin resistance Cell proliferation potential and the relative resistance to doxorubicin were evaluated by cell proliferation assays using MTT assays (sigma). Cells were plated at a concentration of1×103cells per well (for growth advantage assays) or1×104cells per well (for doxorubicin resistance) into96-well culture plates. For the cell proliferation potential assay,20μl MTT solution (0.5%MTT) was added at12h、36h、60h、84h、108h and132h. For the doxorubicinresistance assay,20ul of MTT solution was added to each well of the plate at4h,24h,48h,72h,96h and120h after treatment with doxorubicin at a fnal concentration of10μg/ml. After the addition of MTT solution, plates were incubated for4h. the media was then removed and150ul DMSO added to each well to dissolve formazon crystal. Absorbance was then measured at490nm using a microplate reader (SpectraMax M5, Sunnyvale, CA, USA).7) Irradiation Cells were irradiated with using6-MV X-rays produced by a Varian2100C linear accelerator at Southern Medical University. Does rate was400cGy/min, and cells were irradiated from a vertical direction for the time required to generate a does curve of0,2,4,6,8Gy. Corresponding controls were sham irradiated.8) Clonogenic assay For clonogenic assays, cells were trypsinized into single cell suspension, resuspended in medium supplemented with10%fetal calf serum, seeded corresponding number of cells in6-well plates, and then incubated for3hours before irradiation. Immediately following irradiation, the cells were incubated for 15-25days at37℃in a5%CO2environment to allow the colony formation. After that, the colonies were fixed with pure ethanol and stained with1%crystal violet. Colonies containing>50cells were counted as clonogenic survivors. Plating efficiency (PE)=colonies observed/number of cells plated, Surviving fraction (SF)=colonies counted/[cells seeded x (PE/100). Three independent experiments were performed, each in triplicate. Using GraphPad Prism5software, the average data were fitted into single-hit multitarget formula:S=1-(1-e-D/D0)N where S is the fraction of cells surviving a dose, Do called the "mean lethal dose", is the dose on the straight-line portion of the survival curve to decrease the survival to37%. The "quasi-threshold dose" or Dq, which is the intercept of the extrapolated high dose, was also calculated. N is referred to the extrapolation number which is a parameter to measure the width of shoulder of the survival curve.9) Migration assay Transwell insert chambers with an8-μum porous membrane (Corning Costar, Cambridge, MA, USA) were used for the assay. Cells were washed three times with PBS and1×105cells were added to the top chamber in serum-free media. The bottom chamber was filed with complete media. Cells were incubated for24h at37℃in a5%CO2humidifed incubator. To quantify the number of invasive cells, cells on the top chamber were removed with a cotton-tipped swab, and migrated cells were fxed in methanol and stained with1%crystal violet. Five random felds were counted.10) Construction of the pGIPZ-hsa-mir-200c plasmid The hsa-mir-200c sequence was amplified from genomic DNA of human by forward primer:"5’CAACAGAAGGCTCGAGGAAGTGTCCCCAGGGACT C3’" and reverse primer:"5’ATTCTGATCAGGATCCAACGCTCTCAGCTC AAGACG3’". The PCR products of332bp were reclaimed from agarose gel electrophoresis and cloned into lentivirus shuttle plasmid pGIPZ (Open Biosystems, Huntsville, AL, USA) between the enzyme sites Xho I and BamH I. All constructs were verified by sequencing. Lentivirus packaging followed the standard instruction. Titer of lentivirus was measured by qPCR experiment in293T cells.11) Real time RT-PCR Cells were harvested, and RNA was extracted using Trizol following the manufacturer’s protocol. One microgram of total RNA was reverse transcribed into cDNA using the SuperScript First-Strand Synthesis System. Real-time polymerase chain reactions (PCRs) using the SYBR Green PCR Master Mix were performed using an ABI PRISM7500Sequence Detection System. Data are shown after normalization to18S expression.12) Western blot Primary antibodies included mouse anti-E-cadherin (1:5,000; BD Biosciences), mouse anti-vimentin (1:500;Clone V9, Dako, Glostrup, Denmark), and rabbit anti-CD44(1:5,000;GeneTex Inc., Irvine, CA, USA). Secondary antibodies included rabbit anti-mouse IgG-HRP (1:1,000;Santa Cruz Biotechnology, Santa Cruz, CA, USA) and goat anti-rabbit IgG-HRP (1:1,000;GE Healthcare, Chalfont St Giles, Uk). HRP-conjugated monoclonal mouse anti-GAPDH (kangchen, Shanghai, China) was used as an internal parameter. All antibodies were diluted with5%milk in PBS containing0.1%Tween-20(PBS-T) and incubated for either1h at room temperature or overnight at4℃. All Western blots were visualized with ECL Western blotting substrate (Pierce, Rockford, IL, USA).13) Immunofuorescence A total of1×105cells per chamber were plated into Lab-Tek two-chamber slides overnight. The next day, when cells were50-70%confuent, they were washed with PBS twice, fxed in3%paraformaldehyde (Sigma) and permeabilized in0.1%Triton X-100(Sigma) in PBS buffer at4℃for30min. The cells were then washed3times with PBS and incubated with blocking solution (10%goat serum in PBS). The cells were then incubated with primary antibodies for anti-E-cadherin (BD Biosciences) or anti-vimentin V9(Clone V9, Dako) overnight at4℃. The cells were washed three times in PBS and incubated with the secondary antibody, goat anti-mouse-Alexa Fluor488(1:1,000; Molecular Probes, Invitrogen) in blocking buffer for1h at room temperature in the dark. Finally, the cells were washed three times in PBS and incubated with0.25mg/ml DAPI (Roche) for1min at room temperature in the dark. The slides were washed exten-sively with PBS and mounted with Fluoromount-G (Southern Biotech, Birmingham, AL, USA). All matched samples were photographed (controls and tests) using immunofuorescence microscope (Olympus BX51, Tokyo, Japan) with identical exposure times.14) Immunohistochemistry The expressions of EMT-related markers (E-cadherin, vimentin and fibronectin) and BrCSC-related markers(CD44and CD24) were detected by immunohistochemistry.15) Statistical Analysis In all experiments, differences among groups were analyzed by chi-square criterion or variance (ANOVA) method using SPSS (13.0) software. Bonferroni method was used for multiple comparisons. A probability level of0.05was chosen for statistical significance.Results1) Cells with tumorigenic potential are common in breast cancer cell lines CSCs and non-CSCs were isolated by flow cytometry based on CD44/CD24antigen marker profile from these6breast cancer cell lines, and then compared frequencies of tumorigenic cells between CSCs and non-CSCs based on OCTAs. CSCs and non-CSCs exhibited almost the same frequency of clonal and tumorigenic cells.2) The enrichment of CD44+or CD24-cells in sphere culture system is associated with epithelial-mesenchymal transitionMammosphere cells developed a gene expression pattern associated with EMT even within24h of mammosphere culture, including induction of mesenchymal markers, vimentin and Twist, along with the induction of CD44or CD24repression. Cells suspended in mammosphere media were plated on high attachment plates and allowed to grow as adherent cells. Morphological changes from a cobblestone to a spindle-like morphology, a classical marker of EMT induction, were seen even48h after exposure to mammosphere media. Consistently, the immunostaining also showed the repression of epithelial protein marks and induction of mesenchymal markers.3) Cancer stem cells are a subpopulation of cells with mesenchymal-like propertiesNon-CSCs were cultured in media with50ng/ml IL-6,20ng/ml EGF and20ng/ml bFGF, or10ng/ml TGF-β1in37℃and5%CO2condition. These cytokines, without exception, induced CD44+cells in luminal cancer lines and CD24-cells in basal cancer lines after10-days exposure, which was miraculously consistent with the enrichment of these cells in mammosphere culture. To test the resulting CD44+or CD24-cells were just a subpopulation of cells which underwent EMT in response to exposure of some EMT-inducing cytokines, CSCs (CD44+cells or CD24" cells) from cells10d-exposured by cytokines were isolated, and then gene expression patterns associated with EMT were compared with non-CSCs without any cytokine-exposure. CSCs exhibited a gene expression pattern that was consistent with EMT, compared with non-CSCs, including E-cadherin repression and the concomitant activation of mesenchymal markers, such as vimentin, N-cadherin, and fibronectin, which was accompanied by the induction of CD44or the repression of CD24. The expression changes of EMT-related markers were also confirmed by indirect immunofluorescence labeling.4) EMT only confers other malignant characteristics but not tumorgenicities on cancer cellsCD44+or CD24-cells induced by cytokine exposure only exhibited similar frequencies of tumorigenic cells compared with cells without any exposure to cytokines. Nevertheless, CD44+or CD24-cells induced by cytokines, except for TGF-β1, displayed significantly enhanced proliferation potential (Figure2A), increased resistance to radiation (Figure2D), and reduced cell death after doxorubicin treatment compared with CD44-or CD24+cells, which was consistent with the enhanced malignant characteristics of breast cancer stem cells (BrCSCs) reported in previous studies. Additionally, the CD44+or CD24-cells induced by cytokines including TGF-β1exhibited increased invasive potential compared with CD44-or CD24+cells, as demonstrated by transwell assays.5) Distinct speed of cell-proliferative expansion may lead to discovery of CSCs Isolated CSCs and non-CSCs were transplanted into the mammary fat pads of immunocompromised NOD/SCID mice based on limiting dilution analysis. Just as most previous reports, non-CSCs exhibited repressive tumorigenic potential compared with CSCs80days after injection. However, tumorigenic frequencies of non-CSCs approach to those of CSCs with prolonged time of observation. Non-CSCs injected with matrigel containing growth factors EGF and bFGF displayed miraculously enhanced tumorigenic potential compared with those injected with matrigel without growth factors, and more interestingly, non-CSCs injected with growth factors even produced more, at least with the same effect, tumors than CSCs.6) Tumorigenicity is independent on mesenchymal-like feature in tumor cellsThree mesenchymal-like cell lines BT549, MDA-MB-231and MDA-MB-435S were induced into epithelial-like phenotype through mesenchymal-epithelial transition (MET) by transfecting MET-induced small noncoding regulatory RNAs miR-200c which has been established to be a potent MET inducer in mesenchymal-like cancer cells. Morphological changes consistent with the cells undergoing MET were seen in cells transfected with miR-200c. Quantitative real-time PCR analysis showed a gene expression pattern consistent with MET including induction of E-cadherin and repression of most mesenchymal markers. This induction of MET coincided with repression of CD44expression and thus led to generation of CD44-/CD24-/low cells, which was demonstrated by flow cytometry. Functionally, MET induced by overexpression of MiR-200c resulted in significantly slowed growth, reduced invasion, and increased susceptibility to radiation or doxorubicin treatment compared with control cells. Nevertheless, miR-200c did not affect the frequencies of clonal cells and tumorigenic cells, although miR-200c-treated cells exhibited slower growth clones and spend more time to form palpable tumors in immunocompromised mice than corresponding control cells.7. CD44+/CD24" phenotype was identically associated with cells with mesenchymal-like phenotype in clinical samplesAccording to expression patterns of CD44and CD24, these breast carcinomas were subdivided into two main subgroups. Subgroup A was defined as samples with non-CSCs phenotype (CD44+/CD24+, CD44-/CD24+, or CD44-/CD24-/low phenotypes), and subgroup B was defined as samples with CSCs phenotype (cells with CD44+/CD24-/low phenotype). We observed that mesenchymal-like markers, expecially vimentin, were significantly more frequent in tumors with subgroup B, while epithelial-like marker E-cadherin expression in subgroup B was remarkably repressed compared with that in subgroup A.Conclusions1) Cells with tumorigenic potential are common in breast cancer cell lines.2) The enrichment of CD44+or CD24-cells in sphere culture system is associated with epithelial-mesenchymal transition.3) Cancer stem cells are a subpopulation of cells with mesenchymal-like properties.4) EMT only confers other malignant characteristics but not tumorgenicities on cancer cells.5) Distinct speed of cell-proliferative expansion may lead to discovery of CSCs.6) Tumorigenicity is independent on mesenchymal-like feature in tumor cells.7) CD44+/CD24-phenotype was identically associated with cells with mesenchymal-like phenotype in clinical samples. |
PDF Full Text Request