The Preliminary Study Of Induction Of Hair Follicle By Immortalized Dermal Cell Implantation

Background:Nowadays, hair restoration surgery technique, although its curative effect affirmation, hold out for long time, it got a large number of bald-headed sufferer’s approve. But no matter which repair technique of adoption, all with the sufferer own to amplify provide area hair from the body for premise. For those sufferer whose bald area is too big or the even hair complete shattered, these repair the technique often can’t use. Even these techniques are used, under the effect of the shortage of providing area and the transplant rate unsteady, the hair density after operation can’t attain satisfaction. Besides none surgical operation can create new hair and can’t increase the amount of hair. Many bald-headed sufferer’s hair is losing every day, hair restoration surgery technique can’t make it stop, either, can’t estimate it develop circumstance. So, the shortage of the resources of hair area is obvious and become the present hair repair surgery more difficult problem for solve.Hair follicle is structure is very different than other organization, and has a special immunity. Hair follicle is the result of the interaction between epidermises. This property is the basis of an emerging cell therapy called follicular cell implantation (FCI) in which dermal papilla cells taken from a few follicles are expanded in culture and then implanted into the skin to induce the formation of many new follicles. Some researcher injected DCs which separated from neonatal C57BL/6mice’s skin into nude mice’s skin. Then the few follicles can be found after8-12days. The inability to expand hair-inductive DP cells in culture was probably the most important barrier to the development of FCI, because insufficient expansion would not provide enough cells to regenerate a significant number of new follicles and the therapy would not provide an advantage over existing hair transplantation.Immortalized cell lines which have hair follicle induction can provide a new direction for FCI. Telomerase is a reverse transcriptase that synthesizes DNA repeats using RNA as a template to maintain the length telomere. Telomerase reverse transcriptase (TERT) is the catalytic subunit of telomerase, the expression level of which has a strong correlation with the activity of telomerase. Introduction of TERT gene into transected cells leads to stable expression of telomerase, maintenance of the chromosomal integrity and sustainable cell growth in a long time. If we can establish a mature hair follicle cells line, we also can prove a new way for getting a large number of hair-inductive DCs.High titer of retro virus pLEGFP-N1-TERT mediates high-level expression of exogenous TERT gene in the neonatal mouse hypoderrnal cells. Our findings provide potential applications for skin tissue engineering and cell transplantation therapy.Objective1. To establish the method of separation、culture、identification for neonatal C57BL/6mice’s dermal cells.1.1To establish the method of separation for C57BL/6mice’s dermal cells.1.2Culture the dermal cells, observe cell morphology and growth circle.1.3Point out actual significance for hair-inductive ability.2. To establish the method of immortalized dermal cell. 2.1To confirm the TERT primers design and construct vectors.2.2Toestablish a method for package of the retrovirus, transferring cells and screening using G418.2.3To observate cells line and culture characteristics, test hair-inductive ability.3. To establish the method of FCI.3.1To confirm the method of FCI.3.2To confirm the new follicle was composed by injecting cells.METHODS:1. Primer design for gene cloning:Primers were designed based on the expression vector map, sequence of TERT gene was obtained from NCBI (NM:009354), primers are designed as follows: TERT-F:5’CCCAAGCTTATGACCCGCGCTCCTCGTTG3’; TERT-R:5’ACGCGTCGACCGGTCCAAAATGGTCTGAAAGTCTGT3’.2. Construction of retro viral vector pLEGFP-N1-TERT Total RNA was isolated form livers of neonatal mice, cDNA was synthesized and PCR product was detected by agarose gel electrophoresis. Recovered3369-bp DNA fragments from the gel and the vector were digested by Hind III and Sal I respectively, and then were inserted into pLEGFP-N1with T4DNA ligase. Product of ligation was transduced into STBL3cells. Colonies were identified by colony PCR and restriction enzyme digestion and finally confirmed by DNA sequencing of double strands (Invitrogen Co., Shanghai, China). Positive colonies were cultured in Lysogeny broth (LB) and plasmids were purified and verified by BamH I digestion.3. The DNA was extracted by alkaline lysis method from escherichia coli, then combination reaction was happened in solution by column chromatography. Adsorbing column was made by materials based on silicon.Blank vector were transfected at the same time. 4. C57mouse dermal cells’separation and cultivation. We shuck c57neonate rats’ skins and cut into small fragments,0.5cmx0.5cm。 And the skin fragments were incubated in0.1%dispase for16h at4℃. Then separated the epiderm and derma by microforceps。The derma was cut into trivials, then were incubated in0.2%collagenase for30min at37℃. And immerse them in a supplemented mixture medium of Dulbecco’s modified Eagle’s medium (DMEM) containing10%fetal bovine serum to stop digesting. Then removeled tissue chip and cell aggregate. The culture was incubated at37℃and5%CO2in air, and the medium after24h. The cells were divided into2groups:pLEGFP-N1group (control); pLEGFP-N1-TERT group.5. The total RNA of was extracted and reversely translated(RT) into cDNA. Using the real-time quantitative polymerase chain reaction,the relative level of tere was detected in24h、36h、48h.6. The pLEGFP-N1and pLEGFP-N1-TERT were obtained and then transformed into the expression host STBL3. To treat with Buffer Ⅱ,then turned upside down, adding denaturing solution,on ice,10min.Then add11gCscl and lmlEB in solution, centrifugal.After adding extractant of water-saturated n-butanol, shake the solution, and solvent extraction few times.Then adding lml TE,2.5times anhydrous ethyl alcohol,let stand for10minutes at the room temperature.7. After adding ddH2O110μl,1MCaCl250μl, PIK20μg,2XHBS200μl, plasmids pLEGFP-N1(used as control) and pLEGFP-N1-TERT were respectively transformed into STBL3competent cells. Amplified recombinant plasmids were extracted by CsCl density gradient centrifugation and co-precipitated with calcium phosphate for transfection into293FT packing cells, respectively.8. Supernatants containing these two retroviruses were filtered by0.45um filters, respectively. Hypodermal cells of neonatal mice were infected with retrovirus plus polybrene (2μg/ml) and the transfected cells were selected by G418and the stable cell line was subcultured after a7-day selection. Retrovirus titer was calculated by the following formula:titer (PFU/ml)=number of GFP positive cell x dilution factor/0.01ml.9. Cytoactive detection:cell suspension and0.4%trypanblau mixed at the ratio of1:1, then dropped in cell countiong plate and observated by microscope. The living cells were uncolored and splendent; the dead cells were colored and cell body expanding.Counting uncolored cell population and total cellular score and the percentage.The transfected cells were examined by MTT to draw the growth curve and evaluate cell growth.10. Western Blot:The total proteins extracted from cells,then50ug protein was selected to Transfer to polyvinylidene fluoride (PVDF) membrane by PAGE,60V,1.5h. Be closed in5%skim milk at37℃1h, With antibody dilution (concentration1:3000), incubated overnight in4℃. The optimal concentration of antibody dilution for coating were1:6000, incubated the corresponding membrane, shaking for120mins. To be exposured by chemiluminescence ECL.Using β-actin as an internal standard.11. Flow cytometric analysis:The mouse fibroblast cells which activity were>95%by typran stain were seeded in12-well plates as106/kong. Cells were collected by0.25%trypsin. Re-hanging in the solution which were contained1:50FITC-CD34antibody and1:50FITC-CD44antibody or1:20FITC-CD133antibody (in1:50mouse IgG/FITC as a control).37℃,30min. Flow cytometry excitation wavelength Ex=488nm; emission wavelength Em=530nm. Test positive rate.12. Immunohistochemistry detection:The cells were seeded on cover slips, PBS rinsing two times (5min/times),4%formalin-fixed30minutes then the PBS rinse three times (5min/times).0.1%Triton X-100/0.1%sodium citrate solution, rupture of membrane at room temperature for10minutes, PBS washed three times (5min/ times). Closure of endogenous peroxidase:3%H2O2were incubated at room temperature for10minutes, PBS washed three times (5min/times). Normal goat serum at room temperature closed to10minutes.TERT/versican (concentration: TERT1:150; Versican1:100) incubation:the cells seeded in DAKO antibody diluent diluted antibody solution were incubated overnight in4℃. Rewarming for15minutes.PBS wash three times (5minutes/time) DAKO anti-mouse/rabbit incubated at room temperature40minutes. PBS wash three times (5minutes/time). DAB color,1-10minutes at room temperature, under the microscope control. ddH2O washed three times,5minutes/time. After hematoxylin, PBS back to blue. Dehydration, transparent, mounting by neutral gum. The results were to take a photo by otter BK5000biological microscope, Nikon D60camera.13. Flow cytometry was used to study the effect on cell cycle.After the cells had been treated, add into absolute ethanol, incubated overnight in4℃.Then study the effect on cell cycle.14. We shuck c57neonate rats’skins and cut into small fragments,0.5cmx0.5cm。 And the skin fragments were incubated in0.1%dispase for16h at4℃. Then separated the epiderm and derma by microforceps。 The epiderm was cut into trivials, then were incubated in0.2%collagenase for30min at37℃.15. Hair follicle cells implantation. Nude mouse4-6w, female or male. Nude mouse were anesthetized using0.8%napental. Sterilize the skin of back. Implanted the mixed cells under the skin of the nude mouse by injecting. Then observated the hair follicle formation, growth, reconstruction and hair shaft condition. The histologic examination of the skin was performed after the21days. RESULTS:1. PCR products in agarose gel electrophoresis showed a3369-bp DNA fragment, which was consistent with the size of the target gene.2. Extracted plasmid digested with BamH I produced a fragment of about1800bp. consistent with what we had expected, suggesting that TERT has been inserted into pLEGFP-Nl vector. DNA sequencing verified that the sequence was correct.3. TERT showed a gradual and stable decrease with the prolong-ing of time by QPCR.4. According to calculation, the titer of retro virus was1.0x109PFU/ml. Cells stably expressing GFP attached within24h after split. The cells first appeared round, non-uniform in cell size, with high nuclear/cytoplasm ratios. Then the cells gradually extended to be short spindle-shaped, polygonal or spindle-shaped. Green fluorescence was observed under a fluorescent microscope. Seven days after split, the primary cultured cells reached70%-80%confluency.5. The growth of cell transfected with pLEGFP-N1-TERT was slow gradually compared with control.6. The results of Flow Cytometry showed the cells in G2/M were significantly increase.7. Expression of TERT、BMP-4was detected by Western blot,Versican was detected by immunohistochemical analysis, CD44、CD133were detected by Flow Cytometry, both of which showed significantly increased expression of TERT after infection.8. We could see slightly elevating and pigmentation on the transplant site after implanting3weeks Generally observed3weeks,and turnout the graft site, we could see the hair fiber by stereomicroscope and which could erupt after3weeks.9. Histologic examination:mixed cells were injected after3weeks, and transplanted tissue sections stained area. There were a large number of hair follicles was arranged in concentric circles structure, and their centers were keratinized eosinophilic staining material, outside the following order:inner root sheath, outer root sheath, dermal sheath.CONCLUSION:In this study, we successfully constructed the retroviral vector pLEGFP-N1-TERT. After transfection into293FT cells, virus with a titer of up to1.0x109PFU/ml was produced. After infection of mouse hypodermal cells, expression of TERT、BMP-4w、Versican、CD44、CD133increased significantly and expression of green fluorescence protein facilitated cell labeling. It not only will meet the requirements of long-term and large-scale expansion of seed cells, but also will facilitate cell tracking and detection the results of tissue engineering. In all, our study provides new a new view for producing seed cells of skin tissue engineering.