The Role Of MiR-199a In Regulation Of Rat Cardiomyocyte Autophagy

BACKGROUNDAutophagy is a tightly regulated intracellular catabolic pathway involving the lysosomal degradation of long-lasting proteins and nonfunctional organelles, thereby generating fatty acids and amino acids that are used for cell metabolism, which could promote cardiomyocyte survival. During the core autophagy pathway, the precursor form of ubiquitin-like protein microtubule-associated protein 1 light chain 3(LC3) is cleaved by ATG4 to generate the LC3-I. Then, LC3-I conjugates with phosphatidylethanolamine to form LC3-II. In mammals, the conversion of LC3-I to LC3-II is a key step in autophagosome formation and a commonly used experimental marker of autophagy.Micro RNAs(mi RNAs, mi R-) are endogenous non-coding RNA molecules that regulate gene expression at the post-transcriptional level. These small non-coding RNAs play a critical role in a broad range of biological processes including proliferation, differentiation, apoptosis and autophagy, linking them to numerous human diseases including cardiovascular diseases. The role of mi RNAs in the heart was first assessed in the fruit fly. Then mi R-208 a, mi R-1 and mi R-133 were found regulate cardiac hypertrophy. Further studies demonstrated that several mi RNAs play role in controlling important processes that contribute to the pathophysiological consequences of myocardial infarction.During recent years, the physiological importance of the mi RNA-autophagy interconnection has been beginning to be elucidated. After Zhu et al. first published that mi R-30 a regulated autophagy by targeting BECN1, several mi RNAs were demonstrated to impact through the core autophagy pathway. In 2011, Xiao et al. first identified mi R-204 as an autophagy regulator in cardiomyocytes. Other studies have also reported that mi R-30 a regulated cardiomyocyte autophagy through Beclin1 protein and mi R-325 potentiated autophagic responses in cardiomyocytes by targeting ARC during myocardial ischemic/reperfusion injury.Mi R-199 a is predominantly expressed in cardiomyocytes and has been shown be related to several cardiovascular disorders. In the previous study, we discovered mi R-199 a as a regulator of cardiac hypertrophy. However, the relationship between mi R-199 a and autophagy in cardiovascular system remains unknown. In this study, we investigated the mi R-199 a expression level and the role in modulating autophagy in cardiomyocytes. We treated isolated rat cardiomyocytes under serum-free starvation condition in order to induce autophagy. The expression level of mi R-199 a was detected, and then the autophagic activity was analysed after overexpression or knockdown of mi R-199 a. Furthermore, we explored the potential target of mi R-199 a in regulating cardiomyocyte autophagy. METHODS 1. Animals and cell culturePrimary cardiomyocytes were prepared from neonatal Sprague-Dawley rats(Super-B&K laboratory animal Co., Ltd, Shanghai, China). After 75% alcohol disinfection of rat, heart was moved to D-Hanks solution under sterile condition. Then the ventricle was cut into 1mm3 tissue blocks. After collagenase digestion, other heart cells were removed using gradient adherent method. The isolated cardiomyocytes were cultured in Dulbecco’s modified Eagle medium(DMEM) with L-glutamine and 10% fetal bovine serum(FBS), that was socalled complete DMEM. Cardiomyocytes were cultured under starvation condition in Earle’s Balanced Salt solution(EBSS) instead of complete DMEM to induce autophagy. 2. Quantitative real-time polymerase chain reaction(q RT-PCR) analysisTotal RNA was extracted from neonatal rat cardiomyocytes by using Trizol reagent, and the reverse transcription(RT) reactions were carried out using special prime. Real-time PCR was performed using a standard protocol from the SYBR Green Mix kit on a Rotor-Gene RG-3000 A analysis system. U6 was used as references. ΔCt values were normalized to U6 levels. Each sample was analyzed in triplicate. The 2-ΔΔCt method was used to determine the relative quantitation of gene expression. Primers used in the amplification reaction were as follows(shown 5’-3’): rno-mi R-199a-3p Forward, CTGAGTACAGTAGTCTGCACAT; rno-mi R-199a-5p Forward, CTGAGTCCCAGTGTTCAGACT; mi RNAs common Reverse, GTGCAGGGTCCGAGGT; rno-Twist1 Forward, CACGCTGCCCTCGGACAA; rno-Twist1 Reverse, GGGACGCGGACATGGACC; rno-U6 Forward, CTCGCTTCGGCAGCACA, rno-U6 Reserve, AACGCTTCACGAATTTGCGT.3.Construction of adenoviruses and cell transfectionRecombinant adenoviruses(Ad) were constructed, amplified and titered, as previously described by Graham and Prevec. All DNA was delivered to the cardiomyocytes via adenovirus vectors using 10 to 20 multiplicity of infection. Mi R-199a-3p and mi R-199a-5p inhibitor were transfected into cardiomyocytes using Lipofectamine LTX according to the manufacturer’s protocol. The caenorhabditis elegans mi RNA inhibitor with similar design and modification method was used as negative control(NC). Mi RNAs transfection efficiency was determined by q RT-PCR. 4. Western blot analysisAfter starvation, proteins were collected from cardiomyocytes by SDS-PAGE Loading Buffer. Western blot analysis to assess LC3-I, LC3-II, HSPA5 and GAPDH expression was carried out on 10% and 15% SDS-PAGE as previously described. The dilution of primary antibodies were as follows: anti-LC3(1:500), anti-GAPDH(1:1000) and anti-HSPA5(1:1000). The dilution of secondary antibodies were anti-mouse(1:5000) and anti-rabbit(1:10000). Protein bands were detected by Odyssey infrared laser scanning imaging system. 5. Cell immunofluorescenceCardiomyocytes were fixed with 4% paraformaldehyde for 10 min and premeabilized with 1:1000 Triton/PBS, followed by blocking with 5% goat serum for 30 min at room temperature. Then they were incubated with anti-LC3 antibody(1:200) at room temperature for 1 h. After washing with PBS for 2 times, the secondary antibody coupled with Alexa Flour 594(1:200) was added and incubated for 30 min at room temperature. Followed by washing with PBS, the nuclei were stained with DAPI. Samples were examined under a Leica fluorescence laser scanning confocal TSC-SP5 microscopy. The intracellular autophagosomes and autolysosomes were probed as LC3 red dots in cytoplasm. 6. Transmission electron microscopyFor electron microscopy, cardiomyocytes were cultured under starvation condition as described above for 4 h. Cardiomyocytes were then treated as previous described. Imaging was done using a HITACHI H-7650 transmission electron microscopy(TEM). Double-membraned autophagic vacuoles or autophagosomes detected under TEM were valid and important for the qualitative and quantitative analysis of autophagy. 3. Construction of adenoviruses and cell transfection 7. Dual luciferase reporter assayLuciferase reporter plasmids fused with 3’ UTR of Hspa5 m RNA and mi R-199 a mimic were co-transfected into 293 T cells. 24 h later, cells were lysed. Luciferase activities were measured using a dual luciferase-reporter assay kit(Promega) on a luminometer(Lumat LB9507). Results were evaluated through normalization of the firefly luciferase activity with renilla luciferase activity as previously described. 8. Statistical analysisData are expressed as mean ± standard deviation(SD) from at least three separate experiments. The differences between groups were analyzed using two-tailed unpaired Student’s t-test. Differences were deemed statistically significant at P <0.05. RESULTS 1. Starvation induced autophagic activation in cardiomyocytesUnder starvation by EBSS for 4 h, autophagy was clearly activated in isolated rat cardiomyocytes. Western blot showed that the densitometric ratio of LC3-II/LC3-I was significantly increased in starvation group compared with the control group that was cultured in nutrient state by complete DMEM. The fluorescent LC3 dots in starvation group, which presented accumulation of autophagosomes, reflected induction of autophagy in cardiomyocytes. We also assessed the double-membrane autophagosomes using TEM, by which typical double-membrane autophagosomes were observed under starvation. The above results supported that autophagy was activated as an adaptive response of cardiomyocytes under starvation stress for 4 h. 2. Starvation resulted in down-regulation of Twist1 and mi R-199 a during autophagyAs mi R-199 a was described to have effect in cardiovascular diseases, we focused on identifying the changes of mi R-199 a expression after starvation to investigate the underlying mechanism for the cardiomyocyte autophagy. The q RT-PCR results showed that both mi R-199a-3p and mi R-199a-5p expression levels were significantly decreased in cardiomyocytes after starvation. To further analyze the mechanism of which mi R-199 a was down-regulated, we detected the expression level of transcription factor Twist1 by q RT-PCR. The results showed that Twist1 expression level was significantly suppressed under starvation condition. As the transcription factor Twist1 drove the expression of a 7.9-kb noncoding RNA transcript(from the Dynamin-3 gene intron) that encoded mi R-199 a, down-regulation of Twist1 could depress the transcription of mi R-199 a and result in down-regulation mi R-199 a. These data indicated that decreased expression of Twist1 reduced the mi R-199 a expression level, which was related to starvation-induced activation of autophagy in cardiomyocytes. 3. Overexpression of mi R-199 a suppressed cardiomyocyte autophagy induced by starvationTo study the role of mi R-199 a in starvation-induced activation of autophagy, we subjected the rat cardiomyocytes to starvation in the absence or presence of excess mi R-199 a. An adenovirus expressing mi R-199a(Ad-mi R-199a) was generated. The adenovirus vector(Ad-vector) was used as a control. The expression levels of mi R-199a-3p and mi R-199a-5p were detected when cardiomyocytes were infected for 48 h. The results showed that infection of cardiomyocytes with Ad-mi R-199 a markedly increased the expression of mi R-199a-3p and mi R-199a-5p levels to 12-20 folds by q RT-PCR analysis. After being infected by Ad-mi R-199 a or Ad-vector for up to 48 h, the cardiomyocytes were treated under starvation for 4 h. Western blot analysis showed that the ratio of LC3-II/I in Ad-mi R-199 a group significantly reduced by 52% compared with the control group. The immunofluorescence analysis also demonstrated that under the same starvation condition, the amount of red LC3 dots in Ad-mi R-199 a group was less than the control group. These results indicated that overexpression of mi R-199 a suppressed the starvation-induced cardiomyocyte autophagy. 4. Down-regulation of endogenous mi R-199 a activated starvation-induced autophagy in cardiomyocytesAs mentioned above, both mi R-199a-3p and mi R-199a-5p expression levels were up-regulated in cardiomyocytes infected by Ad-mi R-199 a. To determine which one of mi R-199a-3p and mi R-199a-5p played the main role in regulating autophagy, rat cardiomyocytes pretreated with mi R-199a-3p or mi R-199a-5p inhibitor was studied. Western blot demonstrated markedly enhanced activity of starvation-induced autophagy represented by the ratio of LC3-II/I in cardiomyocytes pretreated by mi R-199 a inhibitor, especially in the mi R-199a-5p inhibitor group. Moreover, fluorescence microscopic examination also showed there were more red LC3 dots in cardiomyocytes treated by mi R-199a-3p or mi R-199a-5p inhibitor, compared with the mi RNA inhibitor NC group, and the effect was more significant in mi R-199a-5p inhibitor group. The results suggest that down-regulation of mi R-199a-3p or mi R-199a-5p during starvation condition, especially mi R-199a-5p, was required for the activation of cardiomyocyte autophagy. 5. Mi R-199 a directly suppressed HSPA5 expression in cardiomyocytes during starvation-induced autophagyTo further explore the mechanism by which mi R-199 a regulated starvation-induced autophagy, we searched for potential targets of mi R-199 a. Computational prediction of targets by mi RBAse and Target Scan identified Hspa5(heat shock 70 k Da protein 5) as a mi R-199 a target gene. HSPA5, also called GRP78, was an endoplasmic reticulum stress(ERS) associated protein, which played a role in ERS-induced autophagy. The 3’ UTR Hspa5 harbored a potential targeting site of mi R-199a-5p by bioinformatics. We therefore constructed luciferase reporter vector containing 3’-UTR of Hspa5. The reporter assay showed that mi R-199 a overexpression was able to markedly suppress luciferase expression of p Sicheck2-Hspa5-3’-UTR, and mutation of 5 nt in the mi R-199 a target sequence led to complete abrogation of the suppressive effect. Furthermore, we observed that overexpression of mi R-199 a by Ad-mi R-199 a significantly decreased the HSPA5 protein content in cardiomyocytes compared with the Ad-vector group. Moreover, forced inhibition of mi R-199a-3p and mi R-199a-5p expression both markedly increased the HSPA5 protein content in cardiomyocytes. In the mi R-199a-5p inhibitor group, the effect was more significant. CONCLUSION 1. Starvation condition by EBSS could induce autophagy in isolated rat cardiomyocytes.Analysis showed autophagy was significantly activated after starvation for 4h. 2. During starvation-induced cardiomyocyte autophagy, both mi R-199a-3p andmi R-199a-5p were down-regulated significantly, which were potentially influenced bythe down-regulation of transcriptional factor Twist1. 3. Forced overexpression of mi R-199 a in cardiomyocytes could suppress the autophagicactivity. Conversely, inhibiting mi R-199 a expression, especially mi R-199a-5p, couldpromote starvation-induced cardiomyocyte autophagy. 4. HSPA5 was a direct target of mi R-199 a, and may play a role in starvation-inducedcardiomyocyte autophagy.