| BackgroundNasopharyngeal carcinoma (NPC) is one of the most common malignant tumors in Southeast Asia and southern China, with an incidence of25-50per100,000populations. Despite this, the prognosis remains poor. Although multi-therapy were used in NPC treatment, recurrenceis frequent. In recent years, the concept of cancer stem cell (CSC) or Stem Cell-like tumor cells has been proposed, which is defined as a cell within a tumor that possesses the capacity to self-renew and to generate the heterogeneous lineages of cancer cells that comprise the tumor. EMT is a process that epithelial cell layers lose polarity and cell-cell contacts and undergo the loss of epithelial cell adhesion and cytoskeletal. A hallmark of EMT is the loss of E-cadherin and overexpression of Vimentin, snail and some other mesenchymal markers. Increasing evidence indicates EMT is an important program in cancer cells invasion and metastasis. Cancer stem cells with tumor-initiating potential are often compared to normal stem cells also can self-renew and divide by asymmetric cell division to give rise to differentiated or committed progenitors.MicroRNAs are small noncoding RNAs that mediate posttran scriptional repression through sequence-specific binding to3’untranslated regions (3’UTRs) of target mRNAs, have also been linked to EMT and cancer stem cells. Notably, miR-200c was shown to regulate EMT by inhibiting ZEB1/2, transcriptional repressors of E-cadherin, a known epithelial cell marker. Reports have also indicated that miR-200c regulates stem cells and cancer stem cells population through suppresses BMI1and Suzl2. All these results suggest that miR-200c may have an integral role in modulating EMT and stem cell phenotype.Proto-oncogene c-myc, one of the four factors in induced pluripotent stem cells (iPSCs) was reported to has a close relationship with cancer stem cells. Recently, c-Myc has involved in Nuclear Reprogramming of the Mesenchymal-to-Epithelial Transition (EMT) in Mouse Fibroblasts. Those results implied c-Myc is a critical factor in regulation of the plasticity of EMT-stemness. But the molecular mechanisms in studying c-Myc links with EMT, cancer stem cells and drug resistance is largely unknown. Here, we have expanded the knowledge about c-Myc regulates EMT, cancer setm cells and drug resistance. We show first that c-Myc Promote EMT and stemness by repressing miR-200c expression and, second, that blockade of c-Myc-miR-200c pathway by inhibits of miR-200c can improve drug treatment effective.So, loss of c-Myc or Re-expressing miR-200c can lead to more cancer cell sensitive to the drugs. More over, miR-200c in combination with chemotherapy suppresses tumor growth and prolongs remission in mouse xenografts. This study elucidates c-Myc-miR-200c pathway in regulating EMT and stemness, and reveals a potential therapeutic implication to suppress EMT-associated cancer stem cells through activation of the c-Myc/miR-200c pathway.Objective1. Investigate the biological functions of c-Myc in nasopharyngeal carcinoma (NPC) cancer stem cells.2. To farther understand the roles of miR-200c between cancer stem cells (CSCs) and EMT.3. To further confirm c-Myc directly inhibits transcription of miR-200c through binds to specific promoter elements of miR-200c.4. c-Myc regulates epithelial-mesenchymal transition and cancer stem cells through modulating miR-200c.5. Whether c-Myc/miR-200c pathway is involved in cancer stem cell mediates drug-tolerant.MethodsCell linesAll cell lines were preserved in our laboratory. The NPC cell lines CNE1, CNE2,5-8F were maintained in RPMI-1640medium supplemented with10%newborn calf serum.293T and phoenix were maintained in DMEM growth medium (Gibco) supplemented with4500mg/1glucose,10%fetal bovine serum,100units/ml of penicillin G and100g/ml of streptomycin. Cells were grown in a5%CO2atmosphere at37℃.Plasmids, oligonucleotides, and transfections.Both pLKO.1lentiviral shRNA vector and control shRNA targeting against GFP were from Aldrich-Sigma. c-Myc targeting sequences in shc-Mycl plasmid is CCTGAGACAGATCAGCAACAA, in shc-Myc2plasmid is CAGTTGAAACACAAACTTGAA. The sense and antisense oligonucleotides were annealed and ligated into pLKO.1lentiviral vector. The miR-200c lentivirus expression plasmid was gift from Michael F. Clarke (Stanford University). miR-200a minics, miR-200b minics, miR-200c minics and miR-200c inhibitor were purchased from Genepharma (Shanghai, China). For promoter assays, the5’promoter regions indicated in the figures were amplified by PCR. The PCR products amplified from human genomic DNA containing the5’promoter regions of the miR-200c was inserted into pGL4(Promega) using KpnI and HindⅢ. And the PCR products from human genomic DNA containing the5promoter region of the miR-200c was inserted into pGL4vectors using Kpnl and NheI. The plasmids containing mutations in c-MycBSs in pGL4-200c F1&R2(c-MycBS-200c MUT) was generated using QuikChange Site-Directed Mutagenesis kit (Stratagene) or QuikChange Multi Site-Directed Mutagenesis kit (Stratagene). All primers used for the constructs were shown in Table S1. The plasmids and/or oligonucleotides were transfected into cells using Lipofectamine2000(Invitrogen), The viruses were packaged in293T cells according to standard protocols. Viral production and infection of target cells were previously described (50). and incubated for24-48h according to the manufacturer’s instructions. Stable cell lines were selected using the appropriate antibiotics for at least48h after transfection.Immunofluorescent staining.For immunofluorescent staining, adherent or semi-differentiated spheroid cells were grown on the surface of cover slides. Spheroids staining was performed in96-well microplates. The cells were fixed with4%paraformaldehyde. After rehydration in KB, cells were incubated with respective primary antibodies at37℃for45min. Slides or spheroids were then washed with KB for15min and secondary antibodies were incubated at37℃for45min. The nuclei were stained with DAPI. Sections were examined with a confocal microscopy.10×KB:0.1M Tris, pH7.5;1.5M NaCl;1.0%BSA.MTT assay.Cells obtained from adherent or spheroid cells were seeded in96-well microplates at a density of2,000cells per well. Cells were treated with increasing concentrations of drug as indicated. MTT assay was performed to determine the viability of the cells. The number of living cells is directly proportional to the absorbance at490nm.Western blottingTotal proteins extracts prepared from cells using RIPA buffer (Sigma-Aldrich), subjected to SDS-PAGE, the separated proteins were transferred to PVDF membranes (Millipore), and blocked with5%nonfat dry milk in TBS+0.05%Tween-20. Prestained molecular markers were included on each gel. Blots were incubated overnight at4℃with specific primary antibodies. After extensive washing, the membranes were incubated with peroxidase-conjugated secondary antibodies and protein bands were detected by enhanced chemiluminescence reagents (Pierce Biotechnology) according to manufacturer’s instructions. The following antibodies were used:c-Myc, Suz-12, Bmi-1, Sox2, E-cadherin, Zeb2, Vimentin, GAPDH (Santa-Cruz Biotechnology).Side population analysis by flow cytometryCells were analyzed by FACS when the cells had reached a logarithmic growth phase (24hours after replating). Cells weredigested with0.25%trypsin (GIBCO), washed twice with calcium/magnesium-free PBS, resuspended in ice-cold RPMI1640culture (supplemented with2.5%FBS) at a concentration of1million cells/mL, and incubated at37℃in a5%CO2incubator for10min. The DNA binding dye, Hoechst33342(Sigma-Aldrich, St. Louis, MO), was then added at a final concentration of5mg/mL and the samples were incubated for90min in the dark with periodic mixing. The cells were then washed twice with PBS,1mg/mL propidium iodide (Sigma-Aldrich) was added, and the cells were kept at4℃in dark prior to annalys by a FACSAria Flow cytometer (Beckton Dickson). Because Hoechst33342extrudes from cells treated with verapamil (a calcium ion tunnel antagonist)-sensitive ABC transporters, a subset of the cells were incubated with50mmol/L verapamil for30min at37℃before the addition of Hoechst33342.RNA Isolation, and Quantitative PCRThe total RNA, which also contained small RNAs was isolated using TRIZOL (Invitrogen) in accordance with manufacturer’s instructions. Total RNA was subjected to qRT-PCR used stem-loop RT-PCR method,1mg total RNA was reverse transcribed into cDNA using Two-Step qRT-PCR kit in20mL total volume. The resulting first-strand cDNA was used as template for quantitative PCR in triplicate using SYBR Green QPCR Master Mix kit (Fermentas Life Science). Primers were designed obedience the stem-loop RT-PCR method. Reverse transcribed cDNA (100μL of1:20dilution) and primers were mixed with SYBR Green dye I master mixture in final volume of25mL, and then, according to the manufacturer’s instructions with an Mx3000P cycler (Stratagene). The general amplification protocol (40cycles) was set as follows:initial denaturation for5min at95℃, then denaturation for35sec at95℃, specific primer annealing temperature for30sec at63℃, and amplification at72℃for30sec. To normalize the amount of cDNA in each sample and to guarantee the comparability of the calculated mRNA expression in all samples analyzed, the housekeeping gene U6was also analyzed. Primers listed in Supplementary Table S1. Data represent means±SD; n=3.Immunohistochemistry.For immunohistochemistry, paraffin-embedded sections were deparaffinized in xylene and rehydrated in graded alcohol. Antigen retrieval was done by boiling the slides in10mM sodium citrate buffer, pH6.0. Staining was done using EliVision Plus Kit according to the manufacturer’s protocol. DAB was used as a substrate for peroxidase.Colony formation assaysVector control, c-Myc vetrovirus and miR-200c lentivirs infected NSP CNE2cells were counted, plated in triplicate at200cells per well in six-well plates, and cultured with RPMI1640complete culture for12hours. Cisplatin, Taxol, Adriamycin were added to the growth media at indicated concentrations to form colonies for16days. After most cell clones had expanded to>50cells, they were washed twice with PBS, fixed in methanol for10min, and dyed with crystal violet for10min at room temperature. After washing out the dye, we counted the clone number that contained>50cells and compared the results. The clone formation efficiency (CFE) was the ratio of the clone number to the planted cell number.Migration and invasion assays.Vector and c-Myc vetrovirus infected cells were detached with Trypsin-EDTA, collected in prewarmed DMEM containing trypsin inhibitor (Boehringer), washed once with the same medium and kept in it until used. For invasion assays through Matrigel, a chamber with8μM pore size coated with Matrigel Basement Membrane Matrix was used.10thousands cells in100μl volume RPMI1640culture with2.5%FBS were loaded into the top well. The medium in the bottom well was500μl RPMI1640culture with10%FBS, After incubation at37℃with5%CO2for18h, the membranes were fixed with a solution with10%acetic acid and10%methanol, stained with0.4%crystal violet in10%ethanol for30min. Then, the non-migrating cells, which stay on the upper side of the membrane, were removed by gently wiping the membrane with a cotton swab. After the cells were stained and dried, the migrated cells were counted under a fluorescent microscope (Nikon Eclipse80i) using a20X lens.Xenograft ExperimentsAnimal studies were conducted in strict accordance with the principles and procedures approved by the Committee on the Ethics of Animal Experiments of Southern Medical University. Nude mice (BALB/C nu/nu) were fed autoclaved water and laboratory rodent chow. A volume of100μl of culture medium mixed with Matrigel (BD Biosciences) containing3×106CNE2cells was transplanted into the flanks of mice by subcutaneous injection, and tumor volume was monitored every5days as calculated by the equation V(mm3)=(axb2)/2, where a is the largest diameter and b is the perpendicular diameter. When the tumors reached a size of-70mm3, mice were randomly distributed in four groups (three mice per group) and treated intraperitoneally with cisplatin (2μg/g), miR-200c (50ng/g), and combinations of cisplatin and miR-200c. Cisplatin was four cycles of treatment every5days (days6,11,16,21), miR-200c was six cycles of treatment every3days (days6,9,12,15,18,21), and tumor volume was monitored at various times up to24days.Luciferase assay.Cells were plated in24-or48-well plates24h before transfection. The ratio of experimental plasmid to control plasmid was10:1. psiCHECK2vectors with5’UTR of miR-200c were transfected in a similar manner. Luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega). In brief,24-48h after transfection, cell lysates were prepared by incubating with1x passive lysis buffer for15min at room temperature. Cell lysates were transferred in triplicate to96-well plates and analyzed using Glo-Max Luminometer (Promega) according to the manufacturer’s instructions.Statistical analysisUnless stated otherwise, all experiments were conducted in triplicate. Data are expressed as the mean_SD of at least3independent experiments. The significance of differences between mean values was determined using2-way ANOVA. P less than0.05was considered significant.Result1. The expression of c-Myc and miR-200family is negative correlation, and c-Myc expression results in enrichment of CSCs.(1) Opposites with c-Myc, miR-200a, miR-200b and miR-200c are downregulate in side population.(2) After over-expression of c-Myc significantly increased the Side population in CNE1,CNE2NPC cell lines.(3) The percent of tumor sphere formation in CNE2cells are also increase by the infected of c-Myc vetrovirus2. miR-200c is directly regulated by c-Myc at the transcriptional level.(1) the potential regulatory mechanism between c-Myc and miR-200c, we used PATCH(Gene-regulation.com) to analyze putative c-Myc binding sites (c-MycBSs) in5’promoter located within a2.5kb region upstream of the transcription start site of miR-200c transcripts.(2) After cloned5’promoter of miR-200c including all the c-MycBSs into the PLG4luciferase reporter vector, we found the mutations in the c-MycBSs resulted in more luciferase activities than wild type.(3) We found the mutations in the c-MycBSs resulted in more luciferase activities than wild type.(4) Knockdown of c-Myc markedly increased levels of miR-200c.3. miR-200c suppresses sternness in NPC.(1) Over-expression of mir-200c can suppress the expression of Sox2, Suz12andBmil in NPC.(2) Over-expression of miR-200c has a high SP percentage than the cells treated with GFP control.(3) Over-expression of miR-200c has a high tumor spheres formation than the cells treated with GFP control.(4) Immunofluorescence staining reveals a reduced expression of Sox2, Suzl2and BmI1in miR200c-expressing cells in comparison with the control.4. c-Myc regulates epithelial-mesenchymal transition and side population through modulating miR-200c.(1) EMT is one of the sternness Characteristics in cancer stem cell, overexpression of miR-200c in NPC Cne2cells expressing c-Myc, the cells does not transform to mesenchymal cell morphology.(2) c-Myc may have a role in regulating EMT plasticity and stem cell properties through regulation of miR-200c.(3) Over-expression of c-Myc significantly transform to mesenchymal cell morphology,dispersion and increase cell invasive and migratory capacity.(4) c-Myc regulates side population through the regulation of miR-200c.5. Non-stem cells killed drugs can enrich of CSCs after inhibit of miR-200c and increase the expression of c-Myc.(1) Non-stem cells killed drugs can not kill cancer stem cells, but enrich cancer stem cells.(2) Non-stem cells killed drugs can increase side population.(3) Non-stem cells killed drugs can reduce the expression of miR-200family in NPC.(4) Treated with Cisplatin mesenchymal cell markers Vimentin is high expression, although epithelial cells E-cadherin is lost, at the same time, the expression of c-Myc is increased.6. Inhibits of c-Myc or upregulation of miR-200c increase the drug sensility in nasopharyngeal carcinoma cell line.(1) Cisplatin, Taxol and Ariamycin have some effect in NPC.(2) Overexpression of miR-200c make cancer cells more sensitive to drug treatment.(3) Myc deletion causes significant increase NPC cells more sensitive to the drug.7. miR-200c expression or c-Myc inhibition in combination with chemotherapy prevents tumor relapse in vivo.(1) pretreatment of NPC cells with miR-200c can help chemicals to blocked tumor formation in nude mice.(2) Combinations of cisplatin with miR-200c caused even stronger regression of tumor growth.(3) Combinations of cisplatin with miR-200c treated can inhibits the expression of stem marks.(4) Combinations of cisplatin with miR-200c can decreased the side population.Conclusion:1. MYC through targets miR-200c to regulate Bmil,Suz12and Sox2increase it effects in maintenance the stemness in cancer stem cells.2. Cisplatin, Taxol and Adriamycin in NPC cells, the survival cells has a high percentage in side-population and tumorsphere formation and caused to loss of miR-200c and overexpression of c-MYC.3. c-Myc/miR-200c pathway in regulating EMT and stemness, and reveals a potential therapeutic implication to suppress EMT-associated cancer stem cells through activation of the c-Myc/miR-200c pathway. |