| Lung cancer has the highest incidence and mortality in the world. In our country, more than one million suffer from lung cancer, and the incidence is rapidly gwrothing, but the5-year survival rate is less than15%. So, lung cancer has become the leading cause of cancer death. Lung cancer is classified into non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) according to their pathological features. The former mainly includes lung adenocarcinoma, squsmous carcinoma and large cell lung cancer, and accounts for about80%. SCLC accounts for around20-25%of all cases and is the most malignant and the lowest differentiation tumor. Smoking, environmental pollution is the main predisposing factor, and with the aggravation of environmental pollution, the incidence of SCLC is increased year after year. The epidemiological survey indicated that the age of SCLC was from30to70, and male was more than female. With the deterioration of the environment, the age of SCLC presented a more and more young trend. SCLC originates from the bronchial mucosa or kulchitsky cells, and has a certain neruoendocrine function. The cell morphology in the light microscopy is shuttle or wheat granular, and the cytoplasm is little and the nucleus is larger. Cancer cells arranged densely, and the interstitial cell is little. In electron microscope, cancer cells have typical neuroendocrine axis and could secrete5-HT and adrenocorticotropic hormones (ACTH) and other hormone-like substance. SCLC has four main characteristics. The first, doubling time is short and proliferation is rapid; the second, widely distant metastasis is occurred in early stage; the third feature is sensitive to chemotherapy and radiotherapy and the last feature is easy to relapse and drug after relapse. Although SCLC is sensitive to chemotherapy and radiotherapy, the feature of widely distant metastasis in early stage resulted that the median survival time is about7-12months, and two-year survival rate is about5%, and five-year survival rate is less than2%. So, to explore the mechanism of invasion and metastasis is essential to improve the5-year survival rate.In this present study, we focused on the mechanism of invasion and metastasis in SCLC. In view of the SCLC rapid proliferation and easy to transfer feature, we studied the mechanism of E2F1regulating invasion and metastasis in SCLC. Transcription factor E2F1, a well-documented regulator in the regulating cell cycle, proliferation and apoptosis, has a dual role in the process of carcinogenesis and development. Until now, the expression of E2F1in various tumors including non-small cell lung cancer, small cell lung cancer, breast, prostate, colon and bladder carcinomas has been clarified. Overexpression of E2F1could promote cellular apoptosis and inhibit tumor growth and proliferation in breast and ovarian carcinoma cells, glioma, head and neck squamous cell carcinoma cells, and melanoma cells. E2F1-/-mice could develop a widespread and systemic tumor including lung, reproductive and lymphatic system. On the other hand, overexpression of E2F1could transform the fibroblasts into neoplastic formation, and induce carcinogenesis in the skin and liver of transgenic mice. Recently, E2F1is being received more and more attention because it is associated with the angiogenesis, invasion and metastasis, drug resistance. E2F1could regulate the expression of thrombospondin1, platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR), and MMP9,14,15and16to participate in the invasion and metastasis. Meanwhile, some papers reported that E2F1could drive chemotherateupic drug resistance by regulating ABCG2, bcl2and miR-205. Based on the above results, we found that E2F1was involved in carcinogenesis, invasion and metastasis, and drug resistance. SCLC as the most malignant tumor in lung cancer has a main feature that widely distant metastasis is occurred in early stage. It is well known that E2Fs family has eight members and they have similar DNA binding domain, which indicated that the target genes controlled by E2F1maybe regulated by other E2Fs members. But some research have showed that the target genes regulated by E2F1were distinguished from target genes controlled by other E2Fs members, and speculated that the possible mechanism maybe that E2F1regulated differential genes by binding other transcription factors with its other domains. For example, the recruitment of E2F to thymidine kinase promoter, c-myc promoter, and DHFR promoter required the adjacent SP1consensus site. Interestingly, Alina R et al reported that the patter of E2F1regulating the gene expression was mainly dependent on the DNA binding domain not other domains.Since E2F1has complex and diverse function, and highly presented in SCLC, it is essential to identify the target gene controlled by E2F1to comprehend the role of E2F1in carcinogenesis, development, invasion and metastasis, and drug resistance in SCLC. In this study, we identified the target genes controlled by E2F1, and found that many genes were associated with invasion and metastasis. Next, we found that E2F1could promote SCLC invasion and metastasis by regulating the expressions of MMPs. The last, we analyzed the mechanism that E2F1could promote the occurrence of epithelial-mesenchymal transition, EMT.Part I The identification of target genes controlled by E2F1in small cell lung cancerBased on the analysis of above issues, we firstly identified the pattern of E2F1expression in Chinese Han population, next we identified the target genes regulated by E2F1in SCLC cell lines H1688by Ch1P-to-sequence. Meanwhile, we downloaded the database controlled by E2F1, E2F4and E2F6in various cancer cells, and clarified the possible mechanism that E2Fs family members regulated differential target genes. In this part, the main findings are as follows:一、E2F1was highly expressed in SCLCIn this study, we first identified the E2F1exprrion pattern in Chinese Han population, and identified the target genes by ChIP-to-seq. Meanwhile, we downloaded the ChIP-to-seq database of E2F1, E2F4and E2F6, and analyzed the similarity of target genes regulated by E2F1in differential cells or E2Fs differential members in same cell, and sought to clarify the mechanism that E2Fs family member regulated differential target genes. The major findings are as follows.1. The expression of E2F1in differential pathological lung cancer tissue.Although expression of E2F1had been detected in lung cancer tissue, its expression was inconsistent among different populations, especially in NSCLC. Therefore, we firstly examined E2F1levels in human lung cancer tissues in a Chinese Han population. E2F1expression was positive in95.56%(86/90) of SCLC,50%(5/10) of large lung cancer cell (LCLC), and10%(2/20) of adenocarcinoma samples compared with the normal alveolar sections. However, it was not detected in squamous tissues (0/20). The normal bronchial epithelial tissues with exclusive E2F1expression served as positive controls. In90SCLC samples, the numbers of negative, weak, moderate, and strong positive E2F1staining cases were4,11,23, and52, respectively. In adenocarcinoma samples, only two weak positive staining cases were found. In LCLC samples, two weak and three strong positive staining cases were found.2. The expression of E2F1in differential pathological lung cancer cell linesConsistent with these observations, E2F1was positively expressed in H1688and H446cell lines as well as HBE cells, which served as the positive control. However, weak expressions were detected in A549, H1299and H292cell lines compared with SCLC cells. In addition, E2F1was not detected in SK-MES-1and HFL-1cell lines. Therefore, E2F1expression was predominantly elevated in SCLC tissues and cell lines, suggesting the importance of E2F1in SCLC development and progression.3. E2F1was an independent and adverse prognostic factor for SCLC patients.E2F1was highly expressed in SCLC, but not NSCLC. We next evaluated the association between E2F1lower, moderate, and higher expression and clinicopathological variables by Spearman’s analysis. The results showed that E2F1was significantly associated with clinical stage (r=0.552, P<0.01). Samples from patients with limited disease (LD) displayed weakly-expressed E2F1(13/30), whereas strong staining of E2F1was found in patients with extensive disease (ED,58/60).χ2test was performed to evaluate the significant difference between E2F lower, moderate and higher and clinicopathological variables, and the results showed that there was significant difference between E2F1lower, moderate and higher and clinical stage (χ2=29.506, P<0.01).Patient survival time was collected by follow-up and data showed that the median survival period of patients displaying lower E2F1(including negative staining) was15.67months, and the moderate E2F1and higher E2F1expression groups were13.74, and10.21months, respectively. These results suggested that high level of E2F1was correlated with poor survival in SCLC. Moreover, univariate survival analysis revealed that E2F1(P<0.01) and clinical stage (P<0.01) were prognosis factors in SCLC patients, while other factors including gender (P=0.768), age (P=0.818), smoking (P=0.827), tumor size (P=0.411) were not significant. Multivariate analysis provided additional evidence that higher E2F1expression proved to be an independent and adverse prognosis factor in SCLC (HR=0.461,95%CI:0.230-0.925, P=0.029).二、The identification of target genes regulated by E2F1in SCLC1. The distribution of target genes in genome. The read identification and follow-up analyzes were completed by BGI Biotechnology Limited Company. The peaks were searched and compared in the promoter regions in human database hg19, and the final identified target genes and target lncRNA were4700and626, respectively. The distribution of unique read in genome was as follows, intergenic (57.89%)> down20k (12.87%), exon(2.3%), inron (38.42%), up20k (13.98%).2GO analysis of target genes. To further clarify the function of target gene regulated by E2F1, we classified the target genes by GO cluster analysis. The target genes were divided into three groups in GO database, and they are cellular components, molecular function and biological processes and3593,3799and2362genes belong to the above three classification. The functions of most target genes were involved in cell cycle regulation, DNA metabolism, RNA splicing, cell division and chromosome assembly.3. The analysis of DNA Motif bond by E2F1. Three DNA Motifs were identified by MEME4.7.0software and the three Motifs were as follows:CAGGCCCCGCCCCC, AAACTACAATTCCCAGCAGGCCTTGGGCC and TTTTTTTTTTTTTTTCTATT C. The p value of Motif1,2and3was8.9e-082,1.0e-025and8.0e-016, and the width was15bp,29bp and21bp, and sites numbers were198,17and36.三、The similarity analysis of differential target genes controlled by E2Fs family members.1. The similarity analysis of target genes regulated by E2F1in H1688and helas3cell lines. Some paper reported that the function of E2F1in differential tumor cells was not same, so it is essential to comprehend the role of E2F1by comparing the similarity of target gene in differential tumor cells. Next, we downloaded the database of ChIP-to-sequence in helas3, and identified the target genes by E2F1.5292target genes were identified, in which the genes presenting in H1688and helas3were1864. The target genes only existing in H1688were2836, and the genes only in helas3were3428. Then we used GO analysis to classify these target genes and draw the functional enrichment, and detaily clarified the relationship of these genes. To explore the reason causing the difference of target genes, we compared the E2F1DNA Motif in differential tumor cells. In helas3cells, there were also3DNA Motif. The Motif1was same in H1688and helas3cells, but Motif2and3in H1688were very large difference in helas3cells. Based on the above results, we found that E2F1has same DNA domain in differential cells, but the target genes were obviously different, and the reason maybe that E2F1has different DNA Motif in differential cells.2. The similarity analysis of target genes regulated by E2F1, E2F4and E2F6in helas3cells. Although E2Fs family members have similar DNA binding domain, the target genes were differential. To resolve this problem, we analyzed the target genes controlled by E2F1,4and6in helas3cells. The numbers of target genes by E2F1,4and6were5232,3566and4513in helas3cells. The numbers of common genes of E2F1and E2F4, E2F1and E2F6, E2F4and E2F6were2323,2178and1778, respectively, in which the common target gene regulated by E2F1, E2F4and E2F6 were1275. Then we draw the GO and functional enrichment maps to classify these target genes, and found the reason causing the difference was the differential DNA Motif.Part II The mechanism of E2F1regulating the expressions of MMPs in small cell lung cancerChIP-to-seq results showed that some members of matrix metalloproteinases (MMPs) family could recruit E2F1to their gene regions. Because E2F1highly presented in SCLC and was involved in angiogensis, invasion and metastasis, we focused on the molecular mechanism about E2F1promoting invasion and metastasis of SCLC by regulating the expression of MMPs. The main findings were as follows.一、E2F1was closely associated with invasion and metastasis of SCLC1. The ability of invasion and metastasis was significantly decreased when depletion of E2F1in H1688and H446cells. When transfection of siRNA targeting E2F1significantly abolished E2F1expression in both HI688and H446cells, Serum-induced invasion through matrigel-coated transwell filters was significantly reduced in cells depleted for E2F1. Cells transfected with scrambled siRNA displayed similar migration compared with that of the untreated control cells. Consistent with the transwell results, wound healing assays showed that E2F1knockdown significantly blocked H1688and H446cell migration into the wound areas compared with cells transfected with scrambled siRNA or untreated control cells.2. The ability of invasion and metastasis was significantly increased when supplementing E2F1in A549cells. To further verify the ability of E2F1to promote invasion and metastasis, A549cells (with lower E2F1expression compared with H1688and H446cells) were transfected with an E2F1expression vector and assayed as described above. The results showed that enforced expression of E2F1could promote A549cell invasion and metastasis. These results suggested the importance of E2F1in cell invasion and migration.二、E2F1was involved in invasion and metastasis of SCLC by regulating the expressions of MMPs. 1. The expression analysis of MMPs in SCLC tissue samples. Firstly, we examined the expression of MMP-2,-7,-9and-16in90SCLC samples by IHC staining. The expression of MMP-7was detected in73.33%(66/90) of the specimens, MMP9in86.67%(78/90) of the cases, and MMP16in all samples (90/90). These results suggested that MMP9and MMP16might play an important role in the process of invasion and metastasis of SCLC.2. E2F1knockdown significantly inhibited the expressions of MMP9and16. Next, we determined whether expressions of MMPs were affected by E2F1in SCLC cells. Real time PCR and western blotting results showed that expression levels of MMP-3,-7,-14, and-15were only slightly reduced when E2F1was depleted in both H1688and H446cells, but the expression of MMP9and16were significantly decreased upon E2F1depletion. Based on the observations that MMP9and16were expressed at higher levels in SCLC tumors, it suggested that E2F1may be involved in the invasive potential of SCLC by regulating the expression of MMP9and16.3. E2F1could regulate the expression of MMP16by E2F1binding sites in the promoter of MMP16. MMP16was selected for further study due to its higher expression in SCLC tumor. IHC results revealed that E2F1was strongly positive in SCLC tumor where MMP16was highly expressed, indicating that E2F1was associated with the expression of MMP16. We used Matlnspector analysis to identify two putative E2F1binding sites in the MMP16promoter. H1688, H446, and A549cells (with lower E2F1) were transfected with luciferase constructs driven by the wild-type MMP16promoter or the MMP16promoter with mutated E2F1binding sites and an E2F1expression plasmid. Overexpression of E2F1increased the activity of the MMP16promoter. Furthermore, E2F1could still activate MMP16promoter containing the mutated E2F1binding site (mutant1), but not mutant2, indicating that E2F1could enhance the expression of MMP16and that the sequence (ggtgGGCGggaagaaag, binding site2) was required for E2F1-mediated stimulation of MMP16promoter activity. These results indicated that E2F1stimulated the expression of MMP16by binding the binding site2sequence in the MMP16promoter. 4. E2F1regulated the expression of MMP9by spl and NF-kappa B binding sites.(1) E2F1could regulate the expression of MMP9in SCLC cells. Johnson et al. reported that one E2F1binding site (tcagggaggGAAAaaga) was predicted in the MMP9promoter. Then, we first tested the activity of MMP9promoter containing the E2F1binding site mutant by a luciferase reporter experiment, and found that this site was not functional. However, our results showed that MMP9promoter activity was significantly enhanced when E2F1was co-expressed in H1688, H446, and A549cells, indicating that E2F1regulated MMP9expression via an indirect pathway.(2) Sp1and p65could regulate the expression of MMP9. Previous studies suggested that Sp1and/or p65might be involved in the regulation of MMP transcription. MatInspector analysis identified four putative Sp1and two putative NF-kappa B binding Motifs in the MMP9promoter. Activation of the wild-type MMP9promoter was significantly increased when the cells were cotransfected with a Sp1expression plasmid. The activity of the MMP9promoter Sp1binding site mutant1and2constructs was unchanged, but the MMP9promoter Spl binding site mutant3and4constructs showed significantly decreased activity. Together this data indicated that Sp1upregulated the expression of MMP9by binding to sites3and4, but not1or2in the MMP9promoter.Additionally, overexpression of p65induced activity of the wild-type MMP9promoter, but not the promoter reporter with a mutated NF-kappa B binding site, indicating that p65also plays a role in regulating MMP9expression. Real time PCR and western blotting results validated that MMP9expression was significantly decreased after transfection with siRNA specifically targeting Sp1and p65, indicating that Sp1and/or p65could simulate the expression of MMP9in SCLC cells.(3) E2F1could regulate the expression of sp1and p65. The results described above suggested that Sp1and p65could regulate the expression of MMP9, and our ChIP-to-seq data showed that E2F1was recruited to the sequences of Sp1and p65. Therefore, we speculated that E2F1regulated the expression of MMP9mediated by Sp1or p65. We next explored the correlation among MMP9, Sp1, p65, and E2F1. In addition to high levels of E2F1(95.96%) and MMP9(86.67%) in SCLC, IHC staining in90SCLC samples revealed positive Sp1and p65expression in93.33%(84/90) and98.89%(89/90) of the cases, respectively. The expression of p65was consistent with a previous report, but ours is the first report revealing Spl expression in SCLC. More importantly, E2F1, Sp1and p65were highly expressed in SCLC samples where MMP9staining was also strong, indicating a positive correlation among E2F1, Sp1, p65and MMP9in SCLC tissues. This observation supported the notion that E2F1upregulated MMP9expression, mainly via Sp1and/or NF-kappa B. We next want to examine whether E2F1contributes to the overexpressions of Sp1and p65in SCLC. Depletion of E2F1led to significantly reduced Spl and p65expression in two SCLC cell lines. VEGFR, which was transcriptionally regulated by E2F1, was used as a positive control. Enforced expression of E2F1in H1688, H446and A549cells led to a significant induction of the luciferase reporter driven by the wild-type Spl promoter compared with controls. Furthermore, E2F1overexpression could also stimulate activities of Sp1mutated1and mutated2promoters. However, the activity of Sp1mutant3promoter was dramatically reduced, suggesting that the actgcGCGCcgaatgcc Motif in Sp1promoter was functional and essential for E2F1-mediated induction. E2F1also notably induced p65promoter activity, while mutation of each E2F1binding Motif in the p65promoterresulted in decreased luciferase activity, even with E2F1expression. Together these results showed that E2F1regulated Sp1and p65expressions at the transcriptional level, which subsequently led to enhancement of target gene expression, such as MMP9.Part Ⅲ E2F1was involved in EMT by regulating sip1in SCLCBased on the above results analysis, we found that knockdown of E2F1could inhibite the celluar migration, bue not eliminate the invasion and metastasis, inferring us that there maybe other mechanism. ChIP-to-seq results showed that sip1was the directly regulatory gene by E2F1. However, sip1as an important transcription factor took part into the process of EMT, inferring us that E2F1maybe participate into the process of EMT by regulating sip1. The main results of this section are as follows: 一、E2F1affected the expressions of skeleton and tight junction protein1. The cell morphology and the expressions of other members of E2Fs genes changed after depletion of E2F1in H446cells. We used the lentiviral vector to construct a new H446cell in which E2F1was stable knockdown, and this cell was named H446-E2Flsi. Compared with the negative control, the morphology of H446-E2Flsi cell was changed from thin fibrous to oval wheat, and the ability of migrate was significantly decreased. Meanwhile, we detected the expression of other members of the E2F family. The results showed that the expressions of E2F3and E2F8were significantly increased after stable knockdown of E2F1in H446cells.2. E2F1influenced the expression of cytoskeleton and tight junction protein. The cell morphology was changed after stable knockdown of E2F1, then we detected the expression of the cytoskeletal protein alpha-tublin and beta-actin. The results showed that the expressions of alpha-tublin and beta-actin were significantly reduced, and the expression of tight junction protein claudin-11and ZO-1were significantly increased, but other proteins including claudin-7,-17,-25and occluding were unchanged.二、E2F1affected the expressions of EMT relative proteins1. E2F1effect on the expressions of E-cadherin, beat-catenin, Vimentin and N-cadherin. Real-time PCR results showed that the expression of beat-catenin was significantly increased, and the vimentin and N-cadherin were significantly decreased in H446-E2Flsi cells. Although the expression of E-cadherin was decreased, this change was no statistical difference. The expressions of E-cadherin and beat-catenin were significantly decreased, and the vimentin and N-cadherin were significantly increased in A549cells when E2F1was supplemented. We again detected the expression of E-cadherin in H446cells by western blotting and immunofluorescence, but the expression of E-cadherin was not detectable. The expressions of relative proteins were consistent with the mRNA in A549-E2F1cells. We doubted that there was no E-cadherin expression in SCLC because E-cadherin was no detectable in H446cells. Next, we selected the other cell line H1688as objective to detect the expression of E-cadherin. The expression of E-cadherin was significantly increased in H1688cells where E2F1was silenced by real-time PCR, western blotting and immunofluorescence. In brief, E2F1could promote the EMT occurrence by regulating the expressions of EMT relative proteins.2. E2F1impacted on the expression of sip1, snail and twist. Since E2F1could promote the EMT process, we detected the expressions of sipl, snail and twist. In H446-E2Flsi cells, the expression of sipl was significantly decreased, but the expressions of snail and twist were no significantly changed. In A549-E2F1cells, the expression of snail was significantly increased, but the sipl was significantly decreased. The expressions of protein were consistent with the expressions of mRNA. These results showed that E2F1took part in the EMT by regulating sip1in SCLC, but the mechanism bout E2F1promoting EMT in lung adenocarcinoma cells was complex, and the detailed mechanism need to further research.三、E2F1could regulate the expression of siplThe above results inferred us that E2F1could promote EMT by regulating sip1in SCLC, next we explored the detailed mechanism. Firstly, the expression of sipl in SCLC tissue samples was detected by immunohistochemistry. The results showed that sipl presented almost in all tissue smaples, and the staining of sipl was strong in some samples, where the expression of E2F1was strong, meaning that there was regulatory relationship between E2F1and sipl. Then, we constructed the dual luciferase report vector including sip1promoter. The luciferase activity was significantly decreased when transfected into H446-E2F1si cells. These results confirmed our speculation that E2F1could promote the EMT by regulating the expression of sip1.Conclusions, innovations and defects一、Conclusions1. Transcription factor E2F1highly expressed in SCLC, and could be considered as an independent negative factor for patients suffering from SCLC.2. The target genes regulated by E2F1in different tumor cells were significantly difference. Although E2Fs family members have similar DNA binding domain, the target genes controlled by them were significantly difference. The reason resulting into these results was that their DNA binding Motif was different. 3. The expressions of MMP9and16were higher in SCLC. E2F1took part in the process of invasion and metastasis by directly regulating MMP16, or indirectly regulating MMP9in SCLC.4. E2F1could promote EMT occurrence by regulating sipl in SCLC.二、Innovations and defects1. This study firstly reported the expression pattern of E2F1in Chinese Han population, and firstly reported the expression of MMP7, MMP16, p65and sip1.2. This study firstly reported the target genes controlled by E2F1in SCLC, and compared with the similarity of target genes regulated by E2Fs family members in different tumor cells.3. This study firstly clarified that E2F1could promote the occurrence of EMT, and promote the invasion and metastasis by regulating the expressions of MMPs and sipl.4. The limitation of this study was that the clinical samples were paraffin, not fresh specimens. The second problem was not to clarify the mechanism about E2F1promoting EMT in lung adenocarcinoma. |
PDF Full Text Request