Suppression Of Evi1 Gene Alleviates Osteoporosis Through Promoting Differentiation Of BMSCs To Osteoblasts

Osteoporosis(OP) is considered a complex disease with a strong genetic impact in postmenopausal women and a common cause of fracture. Along with the extension of human life and the arrival of the aging societies, OP has been becoming one of the most important health problems.Now, the treatment of osteoporosis is mainly divided into two aspects: basic measures and drug treatments. While basic measures cover principaly the supplement of Calcium medicinal preparation and vitamin D, drug therapy consists of bone antiresorptive drugs, bone anabolism agents and other drugs. However, current treatment is not ideal because the pathogenesis of osteoporosis is not entirely clear. Therefore, elucidating the molecular forming mechanisms and searching more effective treatment of OP is important for the decreasing bone fracture morbidity and enhancing life quality.There are a lot of mechanisms about development of primary OP and researchers also have make great progress. In recent years, Emerging evidences demonstrated that osteoporosis is associated with stem cell defects, including osteoblast-progenitors(mesenchymal stem cells, MSCs) residing in the bone marrow. Studies have revealed that postmenopausal women who suffer from osteoporosis are more likely to be related with decline of BMSCs’ osteogenic differentiation than those premenopausal women. The augmented volume of adipose tissue was also found in the bone marrow of postmenopausal women, indicating the enhancement of BMSCs’ differentiation into adipocytes. It is hypothesized that suppression of bone mesenchymal stem cells differentiation into adipogenic lineage would alleviate the course of osteoporosis.In order to inhibit the progress of adipogenic differentiation of bone mesenchymal stem cells, first we must validate the molecular mechanisms that regulate bone mesenchymal stem cells(BMSCs) differentiation into adipogenic lineage. Ishibashi J et al. have found that ectopic viral integration site-1(Evi1) is a key regulator in the process of adipocyte differentiation of 3T3-L1 preadipocyte, and interference of Evi1 can inhibit adipogenic differentiation of BMSCs. BMSCs, the precursor cells of adipocytes and osteoblasts, can be seen as a kind of preadipocyte, therefore Evi1 would lead to adipogenic differentiation of BMSCs in vitro.In this study we involved in both cell and animal research. The research mainly includes the following four parts:1. Isolation, culture and identification of rat BMSCs2. To investigate the expression of Evi1 in the proceeding of adipogenesis of rat BMSCs.3 To construct adenovirus vector, use the Ad-sh Evi1 to transient transfect BMSCs and identify the transduction effect and interence effect.4 To establish rat osteoporosis model, treat OP using Ad-sh Evi1 BMSCs injection via the tail vein and observe the therapeutic effects. Section one Isolation, culture and identification of rat bone marrow mesenchymal stem cells ObjectiveTo learn the method of isolation, cultivation of rat bone marrow mesenchymal stem cells(BMSCs) in vitro, and to identify BMSCs throuth morphology, cell surface markers, osteogenetic and adipogenic differentiation. Provide research foundation for further study. Methods 1. Animals4 week specific pathogen free(SPF) grade Sprague Dawley(SD) rats, 100-120 g, were purchased from Animal Center of Chinese People’s Army Military Medical and Scientific Academy, Beijing, China. 2. Isolation of BMSCs and cultivation of BMSCs in primary cultureAnimals were sacrificed through intraperitoneal injection of 5% chloral hydrate sodium. Bilateral femurs and tibias were harvested under aseptic conditions and all soft tissues were removed. Metaphyses from both ends were resected and BM cells were collected by flushing the bone marrow cavity in a sterile petri dish with Dulbecco’s modified Eagle’s medium(DMEM) containing 10% fetal bovine serum(FBS) and antibiotics(penicillin 100 U/ml, streptomycin 100 μg/ml). BMSCs were cultured at 37°C in a 5% CO2 supplemented incubator. 3. Cultivation, purification and passage of BMSCsIn the process of primitive culture, the medium were first changed 24 h after inoculation to remove the unattached cells, and then twice every week until nearly 90 % confluence. Continuous passage was done in order to attain relatively pure BMSCs. Using trypsin-EDTA solution to digest them before passage and the ratio of subculture was 1:/4/5. 4. Cell morphology of BMSCsObserve the cell morphology and growth situation using inverted microscope and photograph simultaneously. 5. Flow cytometry to characterize cultured cellsAn analysis of cell surface molecules was performed on passage 3 cultures of rat BMSCs using flow cytometry. BMSCs were trypsinized and centrifuged by 1000 r/min for 5 minutes room temperature. Count the cells and join the antibody CD34, CD44, CD45 and CD90, for 30 min at 4oC. After washing cells using PBS to remove the uncombined antibody, join the second antibody labeling FITC and PE in a dark place for 30 min, and detect them using flow cytometric analysis. 6. Osteogenetic and adipogenic differentiation capacity of BMSCsThe 3rd passaged BMSCs were cultured in 6-well culture plate until nearly 90 % confluence, join the osteogenic and adipogenic media and the medium were changed twice every week, at the same time set up a blank control without joining induction media. After cells was fixed by 40 g/L paraformaldehyde at room temperature for 10 minutes, we evaluated osteogenic differentiation by alizarin red staining at day 16 and the adipogenic differentiation was assessed at day 21 by staining with oil red-O solution. Observe and photograph them using inverted microscope. Results 1. BMSCs’ morphology and characteristicsPrimary BMSCs were spindle and showed radial colony arrangement and maintained a fibroblast-like morphology under monolayer culture conditions. Cells kept good growth and could continuous passage over 20 passages. 2. Flow Cytometry of cultured BMSCsFlow cytometric analysis demonstrated that BMSC populations were positive for MSC markers CD90 and CD44, but were negative for hematopoietic markers CD34 and CD45. 3. The identification of osteogenic and adipogenic differentiationAfter osteogenic and adipogenic differentiation, alizarin red and oil red-O staining were positive. BMSCs were capable of differentiating into adipocytes and osteogenic cells under specific induction. Providing the basis for the subsequent experiments SummaryThe whole bone marrow adherence method is simple, and can isolate, purify and amplify BMSCs in vitro. The obtained cells have general biological characteristics of bone mesenchymal stem cells, and also have potentiality of osteogenic and adipogenic differentiation.Section two The expression of Evi1 in the process of adipogenesis of bone marrow-derived mesenchymal stem cells ObjectiveTo observe expression of both m RNA and protein levers of the Evi1 gene in the process of BMSCs’ adipogenic differentiation through using mature adipogenic induction medium. Methods 1. CellsThe 3rd passaged BMSCs isolated through the whole bone marrow adherence method. 2. BMSCs’ adipogenesisThe 3rd passaged BMSCs were seeded on 60 mm diameter plates and adipogenesis was induced at confluence with induction medium of 10%FBS in DMEM supplemented with penicillin/streptomycin(P/S), 200μM indomethacin, 1μM dexamethasone, 0.5m M isobutylmethylxanthine and 0.5μg/ml insulin for 21 days and the medium was changed twice every week. The normal BMSCs were set as control. 3. Analyzation of the m RNA expression of Evi1 using Real-time PCRTotal RNA, extracted from the cells, was reverse transcribed into c DNA under a PCR-reaction system and the condition of Reverse transcription. Record the value of Ct, amplification curve and dissolve curve. Calculate the experimental results(2-ΔΔCT) using relative quantitative methods. 4. Analyzation of the proteinn expression of Evi1 using Western blottingThe proteins were collected from cells at the first 10 days of the BMSCs’ adipogenesis and protein concentration was detected using the BCA Protein Assay Kit. After 10% SDS-polyacrylamide gel was prepared, cellular proteins were loaded, electrophoresis, transfered the membrane, blocked, reacted with primary and secondary antibody, detected using electrochemiluminescence. ResultsThe Evi1 showed great higher in the proceeding of adipogenesis of rat BMSCs than the normal BMSCs’ group, especially at the 3rd day. After then it continued express moderately in the later process of differentiation.Section three Adenovirus vector construction and Effect of Evi1 on adipogenic differentiation of BMSCs in Vitro ObjectiveShort-hairpin RNA(sh RNA)-encoding DNA sequences were synthesized and constructed into adenovirus plasmids in vitro and then adenovirus vector was used to transfect BMSCs. Identificated the transduction efficiency, observe the effects of Evi1 sh RNA on adipogenic and osteogenic differentiation of BMSCs. Provide a potential target point for the treatment of OP in the future. Methods 1. Design and construction of si RNA sequenceDesign and synthesization of two items si RNA sequences, which direct at rat Evi1 m RNA sequence and start from 149 th and 1423 rd sites, were performed by the Invitrogen. It was entirely correct by enzyme digestion and sequencing identification. 2. Construction of Ad-sh Evi1-1 and Ad-sh Evi1-2Short-hairpin RNA(sh RNA)-encoding DNA sequences were synthesized by Invitrogen and constructed into adenovirus plasmids, and adenoviruses were prepared according to previously described procedures. 3. Transfection of BMSCsThe 3rd passaged BMSCs were were inoculated into 60 mm dishes in 10% FBS-DMEM and cultured until nearly 80 % confluence and then were incubated in complete serum free media for 12 hours. Afterwards, cells were treated with si Evi1 or si Control for 6-8 h and then the medium was changed by adipogenic induction medium, which was changed every three days. Transfection efficiency was analyzed by quantifying GFP expression using inverted fluorescence microscope 24 h after transduction. The normal BMSCs were set as control gruop. 4. Analyzation of the Transfection efficiency of Evi1 using Western blottingRNA was isolated at 3th day after transfection; RNA of normal BMSCs was also isolated. Interference efficiency was analyzed by the comparative 2-△ △ CT method with β-actin as endogenous controls at 3 day of each group. 5. Testation of adipogenic and osteogenic markers using Real-time PCRTotal RNA was isolated at 1, 3, 5, 7 days after successful transfection, respectively. Reverse transcription(RT) reactions were completed and then CDNAs were generated from total RNA. Finally, cards were processed and analyzed in the Real-Time PCR Detection System. Record the value of Ct, amplification curve and dissolve curve. Calculate the experimental results(2-ΔΔCT) using relative quantitative methods. 6. Testation of adipogenic and osteogenic markers using Western blottingTotal protein was isolated at 1, 3, 5, 7 days post-transduction, respectively. Protein concentration was detected using the BCA Protein Assay Kit. After 10% SDS-polyacrylamide gel was prepared, cellular proteins were loaded, electrophoresis, transfered the membrane, blocked, reacted with primary and secondary antibody, detected using electrochemiluminescence. Results 1. Design and construction of si RNA sequenceThe sequence of si RNA against luciferase was 5’-CTTACGCTGAGTACTT CGA-3’; si RNA against Evi1 was(si Evi1-1)5’-GGAAGCAACATGGAAAC AA-3’ and(si Evi1-2) 5’- GCAGTGAGGTCTGCCAT- AA-3’. Two items were si Evi1-1: forward 5’- GATCCGGAAGCAACATGGAAACAATTCA AGAGATT GTTTCCATGTTGCTTCCTTTTTTG-3’, reversed 5’- AGCTCAAAAAAGGAAG CAACATGGAAACAATCTCTTGAATTGTTTCCATGTTGCTTCCG-3’; and si Evi1-2: forward 5’-GATCCGCAGTGAGGTCTGCCATAATTCAAGAGATTAT GGCAGACCTCACTGCTTTTTTG-3’, reversed 5’-AGCTCAAAAAAGCAGT GA GGTCTGCCATAATCTCTTGAATTATGGCAGACCTCACTGCG-3’. A scrambled si-RNA was used as a control. 2. The construction and function of adenovirus interference vectorsThe experiment has successful build adenovirus interference carriers of the ectopic virus integration sites. The adenovirus interference carriers dramatically reduced Evi1 expression at m RNA level. The inhibition rate of Ad-sh Evi1-1 and Ad-sh Evi1-2 were 90.9 and 72.3%, respectively in BMSCs’ adipogenesis compared mock and control group at m RNA level. 3. Effects of Evi1 sh RNA on adipogenic and osteogenic differentiation of BMSCs.We mainly used the Ad-sh Evi1-1 subline for further analysis. The expressions of specific osteogenic and adipogenic genes were evaluated by RT-PCR and Western blot at 1, 3, 5, 7 days post-transduction. Our results indicated that specific osteogenic markers: bone sialoprotein(BSP), Osteopontin(OPN) and Osteocalcin(OCN), were down-regulated in adipogenesis of rat BMSCs and were up-regulated in Ad-sh Evi1 transduced BMSCs in both m RNA and protein levels, especially at 7 day. SummaryIn our study, we first construct adenovirus interference vectorvector of the ectopic virus integration sites successfully and transduct into BMSCs. Second, the experimental results substantiate that RNA interference for Evi1 in BMSCs inhibits adipogenic differentiation and can stimulate osteogenic differentiation at the same time. Our data show that Evi1 gene maybe targeted in the future as a therapeutic strategy for enhancing bone formation. Section four Effect of BMSCs transducted by Evi1 sh RNA on alleviation of OP in rats ObjectiveTo establish the rat OP model, and observe the effect of BMSCs transducted by Evi1 sh RNA on alleviation of OP in rats. Methods 1. AnimalsHealthy 8 week specific pathogen free(SPF) grade female Sprague Dawley(SD) rats weighing 220-250 g were purchased from Animal Center of Chinese People’s Army Military Medical and Scientific Academy, Beijing, China. 2. Establish OP modelOP model: animals were anesthetized through intraperitoneal injection of 5% chloral hydrate; In brief, healthy 8 week SPF grade female SD rats were given an ovariectomy through two dorsal incisions. 3. Treatment of OP using BMSCs transducted by Sh Evi1 via tail vein injectionBMSCs transducted by Sh Evi1 were injected into OVX mice via tail vein on postoperative day 7 and sacrificed at day 28 after injection. In the control group, BMSCs or L-DMEM was injected. 4. Detect the effect after treatment with BMSCs transducted by Sh Evi1 4.1 Serum Biochemical Markers DeterminationRats sacrificed at day 28 after injection through intraperitoneal injection of 5% chloral hydrat. After sacrifice, blood samples were taken from the abdominal vena cav. Then serum samples were obtained by centrifuged at 3000 g for 10 minutes and stored at-80℃ before assessment of biochemical parameters. 4.2 Bone Mineral Density(BMD) Determination.Determined by dual-energy X-ray absorptiometry(DXA)at whole femoral shift of the rats. 4.3 Biomechanical Test.Bilateral femurs were harvested under aseptic conditions and all soft tissues were removed. All samples were stored at-80℃ before the serum samples were used to test using rat OC ELISA Kit according to the manufacturer’s instructions. 5. Statistical analysisAll experiments were performed in triplicate and data were expressed as mean±SD at a significant level of P<0.05. We used one-way ANOVA followed by Dunnett or LSD test. Statistical analysis was performed using SPSS 13.0 software. Results 1. Establish the OP model successfullyThe animals were divided into 4 groups. Group 1 was sham operated, while the remaining 3 groups of rats were ovariectomized(OVX). The rats were equally divided into groups of 10 individuals. Rats in OVX were ovariectomized bilaterally whereas those in Sham experienced sham surgery. 2. Serum Biochemical Markers DeterminationThe serum samples were used to test using rat OC ELISA Kit according to the manufacturer’s instructions. The obvious differences among the groups existed, the treatment group being superior to the model group signifiantly. 3. Bone Mineral Density(BMD) DeterminationChanges in bone mineral density(BMD) at whole femoral shift of the rats were monitored using a Norland XR-46 dual energy X-ray absorptiomertry. The BMD results were expressed as g/cm2 and in standard deviation units with reference to the peak bone mass. The BMD results of the two treatment groups were obviously higher than the model group with statistical significance while the BMD results of the two treatment groups and the model group were significantly lower than the normal control group. 4. Biomechanical Test.Both two femurs were harvested after the rat had been sacrificed. All samples were stored at-20?C. Overnight thawing at room temperature of the specimen was allowed before biomechanical test. Three-point bending test and two-point drawing test was performed using INSTRON-5544 material testing machine. The result showed that the determination of the value of biomechanics of the two treatment groups were higher than the osteoporosis model group with statistical significance. SummaryIn the process of alleviating osteoporosis, symptons of the two treatment groups could be released, the treatment group with BMSCs transfected with Sh Evi1 being superior to another treatment group with BMSCs. Our data showed that Evi1 gene maybe targeted in the future as a therapeutic strategy for enhancing bone formation and Evil gene could be an effective drug target to cure clinical osteoporosis.