| Chapter One:the functional and mechanism study of KLF4 in human retinal microvascular endothelial cellsObjectivesAngiogenesis is a physiological process to form new blood vessels from preexisting vasculature, which is required for embryonic development. The therapeutic potential in those diseases has been extensively studied by controlling angiogenesis using anti or proangiogenic drugs. Angiogenic growth factor, vascular endothelial growth factor (VEGF) is well known to promote angiogenesis by activating VEGF signaling pathway.VEGF antibody or VEGF receptor (VEGFR) kinase inhibitors pegaptanib sodium, ranibizumab and bevacizumab has been approved for clinical use to treat cancer, AMD and DR.Although there are some efficacy observed from those treatments, some side effects are frequently occurred including cutaneous lupus erythematosus and intraocular central nervous system (CNS) lymphoma. Therefore, further studies are needed to understand the regulation of VEGF signaling pathways in those diseases. The transcription factor Kruppel-like factor 4 (KLF4), one of four genes in reprograming adult cells into induced pluripotent stem cells (iPSCs) has been implicated by inhibiting epithelial to mesenchymal transition(EMT) during reprogramming process. KLF4 mediated EMT has been linked to tumor metastasis and extensively investigated in several human cancers. EMT promotes angiogenesis by targeting VEGF pathway. KLF4 is a key regulator in maintaining endothelial progenitor cell phenotypes and upregulated by the leukemia inhibitory factor (LIF) and VEGF through activating P-AKT pathway. A recent study showed that KLF4 impairs tube formation in endothelial cells by inhibiting cyclinDl through regulating miR-15a.However,KLF4 was shown to promote sprouting angiogenesis in endothelial cells by regulating notching pathway in a separate study. The properties of human umbilical vein endothelial cells (HUVECs) and HRMECs are different including gene expression profiles The transcription factor Kriippel-like factor 4 (KLF4) has been implicated to regulate cell proliferation, migration and differentiation in a variety of human cells and is one of four factors in induced proponent stem cell reprogramming. However, its role has not been addressed in ocular neovascular diseases. The purpose of this proposal is to investigate its role in angiogenesis and underlying molecular mechanisms in human retinal microvascular endothelial cells (HRMECs).MethodsCell culture- Primary human retinal microvascular endothelial cells (HRMECs) were purchased from Cell Systems (Kirkland, WA) and cultured in Medium131 from Life Technologies (Grand Island, NY) supplemented with 10% FBS from Hyclone (Logan, Utah),1% Microvascular Growth Supplement, 10μg/ml gentamicin,100 U/ml penicillin, and 100 μg/ml streptomycin from Life Technologies (Grand Island, NY) at 37℃ in a humidified 5% CO2 incubator. All experiments were performed on HRMECs within five passages. Lentiviral Vector Production- KLF4 and EGFP Doxycycline inducible and reverse transactivator (rtTA-M3) lentiviral vectors were constructed using standard molecular cloning procedures by our laboratory. The KLF4 shRNA lentiviral vectors KLF4shR1, TRCN0000005316 and KLF4shR2, TRCN0000010934 were purchased from GE Dharmacon (Lafayette, CO). Targeting sequences for KLF4shRNA were 5’GCTCCATTACCAAGAGCTCAT and (KLF4shR1) and 5’GCCAGAATTGGACCCGGTGTA (KLF4shR2). Scramble control, pLKO1-scrambe (#1864) was purchased from Addgene (Cambridge, MA), Lentivirus were packaged in HEK293FT cells and produced as described previously. HRMECs were transduced using 10MOI of lentiviruses and selected with 3 μg/ml puromycin. MTT assay- 5000 cells were plated per well in 96-well plates and cultured for 8 h. Following incubation cells were starved in 1%FBS for 12 h and then treated with VEGF (50 ng/ml) for different time course. Thereafter,10 μl of MTT reagent was added to each well of the plates and incubated for approximately 4 h. The reaction was terminated by adding 100 μl of detergent and plates were incubated at 22℃ in the dark for 2 h. Cell proliferations was calculated by measuring the absorbance (OD) at 570 nm wavelength. Cell migration assay -The transwell migration assay was performed using a modified chamber purchased from BD Sciences (Franklin Lakes, NJ). The chambers were inserted onto 24-well plates. 2x104 cells in 300 μl serum-free M131 were added onto the upper chamber. VEGF was diluted using M131 at the final concentration of 50 ng/ml and added into the lower chamber of each well as the chemoattractant. The medium and unmigrated cells in the upper chamber were removed following 12 h incubation at 5% CO2 incubator. The migrated cells in the lower side of the membranes were fixed with methanol and stained with crystal violet. Images were taken using an inverted microscopy. Migrated cells were counted at least from three different fields and migration rate was calculated by normalizing to vehicle treated control cells. Tube formation assay-MatrigelTM (BD Biosciences) was thawed at 4℃ overnight and 60 μl were added into each well of the 96-well plates for polymerization by incubating 30 min at 37℃. Serum starved ECs were resuspended in M131 medium and plated on the top of the gel and then incubated overnight at 37℃ with 5% CO2. At least three representative fields from each well were selected to count the branch points of tube-like structures and normalized to vehicle treated controls. Luciferase reporter gene assay- 1.5 kb and 0.2 kb Vegf promoter reporter plasmids (kind gift from Dr. Debabrata Mukhopadhyay at Mayor Clinic, Minnesota) were co-transfected into HRMECs transduced with KLF4 Tet-on lentiviral vector with pSV40 Rellina plasmid, respectively and then 1ug/ml DOX was added. Luciferase and renilla activity was measured at 24 h following transfection. The ratio of luciferase vs renilla was calculated. Immunofluoresent staining- To detect the expression of VEGF and KLF4 expression in HRMECs, KLF4-expressing and control cells were fixed for 10 min using 4% PFA, washed three times with 0.1% Tween20 in PBS (PBST), and incubated with blocking buffer (5% normal goat serum,3% bovine serum albumin, and 0.1% Triton-X 100 in PBS) for 1 h. The primary antibodies against VEGF and KLF4 (1:200 dilution, Santa Cruz, Dallas, Texas), were incubated with fixed cells overnight. After rinsing three times for 5 min with PBST, Alexa 488 or 594 conjugated goat anti-rabbit (1:200 dilution, Life Technologies) antibodies were added for 1 h at room temperature. Cell nuclei were counterstained with DAPI (Vector Laboratories, Inc.; Burlingame, CA). Images were taken using a Nikon inverted fluorescence microscope. Western Blot- HRMECs transduced with lentiviral vectors were collected in RIPA buffer (Thermo Scientific) containing 1% Halt Proteinase inhibitor Cocktail (Thermo Scientific). An equal amount of protein (30 μg/lane) was loaded on SDS-PAGE gels and then transferred onto nitrocellulose membranes. The membrane was blocked with 5% non-fat milk for 1 h and incubated with primary antibodies against KLF4 purchased from Santa Cruz (Dallas, TX), GAPDH from Sigma (St. Louis, MO), P-ERK1/2, P-AKT, p-VEGFR2 from Cell Signaling (Danvers, MA).Results of Chapter OneTo investigate the role of Klf4 in HRMECs, we overexpressed and silenced Klf4 using lentiviral vector, respectively. We constructed a Doxycycline inducible lentiviral vector, in which the Klf4 gene was driven by a DOX-responsive promoter (TRE-tight). To induce Klf4 expression in HRMECs, DOX was added at a final concentration of 1 μg/ml in cell culture media for 24 h and the expression of Klf4 was detected by western blot using KLF4 antibody and showed approximately 6 fold increases compared to non-DOX treated cells. To knock down Klf4, we used lentiviral pLKO1 shRNA vector, two different shRNA vectors were used by targeting two different sequences against Klf4 gene. The knockdown effect following transduction and selection with puromycin was examined by western blot and KLF4 expression in HRMECs transduced with KLF4shR1 and KLF4shR2 was approximately reduced 86% and 91% compared to scramble transduced control cells, respectively.To examine the role of Klf4 on HRMECS proliferation, the MTT assay was performed in Klf4-overexpressing and knockdown cells following 50 ng/ml VEGF treatment. The proliferation in Klf4-overexpressing cells (with DOX) was significantly increased compared to control cells (Non-DOX) at 24 h,48 h,72 h and 96 h with or without VEGF treatment (Figure 1A). In K.LF4 shRNA1 and shRNA2 transduced cells, cell proliferation was significantly reduced compared to empty vector transduced control cells at 24 h,48 h,72 h and 96 h with or without VEGF treatment. To determine whether KLF4 affects migration in HRMECs, we performed the transwell migration assay using HRMECs transduced with lentiviral Klf4 over-expression and shRNA knockdown vectors using 50 ng/ml VEGF as chemoattractant, respectively. Over-expression of Klf4 significantly increased cell migration compared to control cells. Similarly, silencing Klf4 expression using two different Klf4 lentiviral shRNAs significantly reduced cell migration with or without VEGF as chemoattractant.To test how Klf4 affects VEGF induced angiogenesis, we performed tube formation assay using both Klf4 over-expression and knockdown cells. Similarly, we found that over-expression of Klf4 significantly promotes VEGF induced tube formation while silencing Klf4 inhibits VEGF induced tube formation in HRMECs.We treated Klf4 over-expression and knockdown cells using 50ng/ml VEGF for 5 and 15mins following serum starvation, and then examined its downstream receptor VEGFR2 and two cellular survival pathways including P-ERK1/2 as well as P-AKT. We found that over-expression of K1/4 enhanced VEGF activated P-AKT and P-ERK1/2 while silencing Klf4 using two different KLF4shRNAs attenuates VEGF induced both pathways in HRMECs. Our finding indicated that Klf4 is a proangiogenic regulator by activating VEGF induced angiogenesis signaling pathway in HRMECs.To further understand the molecular mechanism underlying Klf4 positive regulation of VEGF signaling, we searched the binding sequence of KLF4 in the Vegf promoter region and found three KLF4 binding sites (CACCC) within 1.5 kb upstream sequence from transcriptional initiation site. Therefore, we hypothesized that KLF4 may bind to the promoter of Vegf and activate the Vegf expression. To test this hypothesis, we use luciferase reporter gene assay by transfecting HRMECs using two Vegf promoter constructs with 1.5 kb and 0.2 kb flanking sequences. There is no KLF4 binding sites in 0.2 kb Vegf promoter sequence, but there are three potential binding sites within 1.5 kb promoter region. Over-expression of Klf4 leads to significant up-regulation of luciferase activity in HRMECs transfected with 1.5 kb Vegf reporter vector. However, there is no significant differences in Klf4 over-expressing cells compared with control cells while 0.2 kb Vegf reporter plasmid was transfected. Our results indicate that KLF4 binds to Vegf promoter and activates reporter gene luciferase expression. To further examine our finding that Klf4 regulates Vegf expression, we induced KLF4 expression at different time points using Doxycycline, and then examined VEGF expression in HRMECs using Western blot. VEGF expression was significantly induced at 3,6 and 12 h by adding Doxycycline.ConclusionsOver-expression and knockdown of Kif4 in HRMECs using lentiviral vector, KLF4 promotes VEGF induced cell proliferation. Over-expression of Klf4 significantly promotes VEGF induced tube formation while silencing Klf4 inhibits VEGF induced tube formation in HRMECs. Klf4 enhanced VEGF mediated signaling pathway in HRMECs. Our finding indicated that Klf4 is a proangiogenic regulator by activating VEGF induced angiogenesis signaling pathway in HRMECs. Our results indicated KLF4 transcriptionally binds Vegf promoter and induces Vegf expression, thus subsequently activates VEGFR2 and downstream P-ERK1/2and P-AKT to promote cell survival, migration and angiogenesisChapter two:the functional and mechanism study of miR-27b in mouse vascular smooth muscle cellsObjectivesIn recent years, miRNAs are becoming focused in biological sciences researches. Many physiological and pathological processes are directly related to the miRNAs. MiRNAs as a class of small endogenous noncoding RNAs, which can inhibiting gene expression at the post-transcriptional level and miRNAs play important roles in metabolic process. MiRNAs contribute to the vascular smooth muscle cell (VSMC) phenotypic switch. However, its underlying molecular mechanisms are still largely unknown. The coding genes of miR-27b is located on chromosome 9.MiR-27b is conservative between human and mouse.MiR-27b can inhibit cell growth and cell invasion of gastric cancer, but can promote proliferation of breast cancer cells and cervical cancer cells.MiR-27b enhances migration of human hepatic stellate cells, and may play important roles in intramuscular adipogenesis.MiR-27b can promote endothelial cells proliferation and sprouting, and has effect on neovascularization. The purpose of this proposal is to investigate the roles of miR-27b in mouse vascular smooth muscle cells and the underlying molecular mechanisms.MethodsThe experimental methods of cell culture, MTT assay, luciferase reporter gene assay, transwell migration assay, immunofluorescent staining and western blot are as same as chapter one.Results of Chapter TwoIn order to study the relationship between PDGF and miR-27b in the vascular smooth muscle cells (VSMCs) of the mice, different time points are selected to test the expression level of miR-27b under the PDGF concentration of 20 ng/ml. In the wake of the extension of PDGF processing time, the expression level of miR-27b raises; when the processing time reaches to 6 hours, the rise level of miR-27b shows significant difference to the control group; when the processing time reaches to 24 hours, the rise level of miR-27b comes to 4.67 times of the control group. In order to further define the relationship between PDGF and miR-27b, PDGF in different concentrations are adopted to process mouse VSMCs, the process of PDGF in different concentrations to the rise level of miR-27b all show significant difference to the control group, the PDGF of 20 ng/ml expresses the strongest effect to raise the level of miR-27b which is 5.1 times of the control group. For further study, miR-27b over-expression and knockdown lentiviral vector are established, the expression levels of miR-27b are tested by real-time PCR and the results show that the level of miR-27b over-expression group rises by 55.67% and the level of miR-27b knockdown group reduces by 93.33%.Drawing the growth curve of VSMCs and studying the roles of miR-27b over-expression on cell proliferation, we can see that miR-27b over-expression group processed by PDGF shows the strongest multiplication capacity and the miR-27b knockdown group shows the weakest multiplication capacity. The laser confocal scanning microscope is adopted to acquire the immunofluorescent staining pictures of VSMCs to further study the controlling of miR-27b to cell proliferation. Comparing the expression of PCNA, we can conclude that VSMCs in miR-27b over-expression group grows faster than control cells and faster than VSMCs in miR-27b knockdown group. Cell scratch and transwell are adopted to study the effect of miR-27b on the migration of VSMCs. The result shows that the migration capability of VSMCs in miR-27b over-expression group processed by PDGF is larger than control cells processed by PDGF than VSMCs in miR-27b over-expression group than control cells, and the result of miR-27b knockdown group shows that the migration capability of VSMCs in control cells processed by PDGF is larger than control cells than miR-27b knockdown group processed by PDGF than miR-27b knockdown group. Immunofluorescence is adopted to study the effect of miR-27b in mouse VSMCs on apoptosis and the result shows that miR-27b over-expression retrains the apoptosis of VSMCs and miR-27b knockdown enhances the apoptosis of VSMCs.We continue to study the molecular mechanism that miR-27b operates. And the effect of miR-27b to SMA expression is tested on protein level by western blot. SMA expression quantity of VSMCs in miR-27b over-expression group is significantly lower than control cell group and knockdown group is significantly higher than control cell group, the expression levels of CNN1 and SM22 show no difference among three kinds of cells. By using cell immunofluorescence test, SMA expression quantity shows the highest in miR-27b knockdown group, much higher than the control cell group; however, SMA expression quantity shows the lowest in miR-27b over-expression group, lower than control cell group. The result of luciferase assay shows that when plasmid of miR-27b over-expression and wild type plasmid of SMA3’UTR transfect the mouse VSMCs together, the expression quantity of luciferase decreases, while in the VSMCs transfected by wild type reporter gene vector and miR-27b knockdown plasmid, the expression quantity of luciferase increases which is of significant difference to control group. After detection of AKT and ERK1/2 signaling pathway in mouse VSMCs, we can see that the expression level of P-AKT and P-ERK1/2 in miR-27b over-expression group is significantly higher than control group with or without PDGF processing. With the rise of processing concentration of PDGF, the expression level of P-AKT and P-ERK1/2 raises, miR-27b over-expression group is significantly higher than control group while miR-27b knockdown group is significantly lower than control group.ConclusionsMiR-27b is a proliferative factor in mouse VSMCs and upregulated by the platelet derived growth factor (PDGF). Over-expression of miR-27b enhances mouse VSMCs proliferation and migration while knockdown of miR-27b leads to inhibition of mouse VSMCs proliferation and migration. Knockdown of miR-27b promotes mouse VSMCs apoptosis while over-expression of miR-27b leads to inhibition of mouse VSMCs apoptosis. Moreover, over-expression of miR-27b down-regulates the expression of SMA which is the mouse VSMCs’marker gene while knockdown of miR-27b upregulates its expression. However, miR-27b has no role on VSMCs’ marker gene sm22 and cnnl. VSMCs’ marker gene sma is the direct target of miR-27b. MiR-27b enhances PDGF to activate cellular survival pathways ERK1/2 and AKT. Our data demonstrate that miR-27b is a critical regulator in controlling phenotypic switch of VSMCs and potentially a drug target in restenosis following angioplasty and atherosclerosis. |