| Background and purpose:The cause of the lower limb ischaemia include arteriosclerotic obliteration of extremities., thromboangiitis obliterans, and II diabetic lower limb ischemia, type II diabetic lower limb ischemia is not only to difficult to treat, but also easy to the face the infection, ischemia, necrosis and even the risk of disability and death. Early clinical manifestation include limb cold, numbness of skin, toe nail thickening, foot pale, dorsalis pedis artery and the posterior tibial artery pulsatility weakened or disappeared, intermittent claudication:walking a distance must be stopped to have a rest for a moment,and then continue walking. By the improvement of the ischimia, the symptoms worsened, the claudication distance is more and more short, and rest pain appear.Advanced clinical manifestation include the skin and soft tissue of toe, inside and outside the ankle, heel, foot and other peripheral parts appear necrosis, infection, ulcer, and even the osteomyelitis; sometimes even require amputation or be life-threatening.In order to avoid the occurrence and development of the serious complications of diabetes, the early detection and diagnosis of diabetic lower extremity vascular disease should be done.Lower limb ischemia, caused by peripheral arterial disease (PAD) and characterized by foot ulcer and necrotizing amputation, severely affects patients’ life quality. Early diabetes is easily accompanied by the occurrence of vascular malformation, atherosclerosis and thrombotic plaque. Diabetic lower limb ischemia often occurs in diabetic patients with a long-time medical history. And, in the early stage of ischemia, there are no obvious symptoms. However, when clinical symptoms become apparent, irreversible pathological changes occur in vessels, which, brings difficulties to the treatment. Therefore, it is very important to find early diagnostic methods for lower limb ischemia caused by diabetes, thus reducing the risk for diabetic patients to get PAD and ensure their life quality. Previous studies showed that systemic inflammation factor C reaction protein (CRP) can be recognized as a classic diagnostic marker for increasing risk of PAD. However, CRP is not a specific diagnostic marker for PAD and has many limitations.Cysteine proteinase inhibitor Cystatin C, also referred as Cystatin C, is composed of 120 amino acid residues. It is a cysteine protease inhibitor expressed in various organisms such as plants, animals and protozoa. The gene encoding Cystatin C is located on band 2, area 13 in the short arm of human chromosome No.20. It is approximately 4.3 kb long, including 3 exons and 2 introns, and can be stably and consistently transcribed and translated in all nucleated cells. Under physiological conditions, Cystatin C can inhibit endogenous cysteine protease activity. Previous reports demonstrated that Cystatin C is one of the sensitive indicators for evaluating early kidney damage, however, studies in recent years have showed that its expression imbalance is highly related to the occurrence and development of cardiovascular diseases, such as hypertension, coronary heart disease, atherosclerosis, diabetic lower limb ischemia, and so on. Recently, a research group found that the expression level of Cystatin C is significantly related to diabetic lower limb ischemia, and high expression of Cystatin C indicates increasing risk of lower limb ischemia in diabetic patients.The miRNAs are a group of small non-coding RNAs which are usually 18～22 nucleotides in length and can regulate gene expression. The miRNAs can regulate target genes through interfering their transcription or inhibiting their translation. The miRNAs participates in many signaling pathways. The miRNAs are widely present in various body fluids, such as blood (including plasma, blood platelet, red blood cell, nucleated blood cell), urine, and so on, and are not degraded by endogenous RNA polymerases. Numerous reports showed that blood miRNAs are not only the regulatory molecules of inner-cell gene transcription and expression but also the signaling molecules of inter-cell signaling pathways. The miRNAs play important roles in multiple processes of cardiovascular cells and tissues, such as development, proliferation, migration, apoptosis, metabolism, damage, regeneration, repair and phenotype change. They also participate in the occurrence and development of all cardiovascular diseases, including coronary heart disease, myocardial infarction, heart failure, hypertension, arrhythmia, myocardial fibrosis, cardiac hypertrophy, heart failure, and so on. Besides, miRNAs have strong tissue, pathological and normal-state specificity and sensitivity, which meets the criteria of ideal biomarkers. In the process of atherosclerosis, circulating platelets in the blood can directly adhere to vascular lesion sites and release various regulatory factors including miRNAs to accelerate disease progression.In this study, the relationship between miR-92a and Cystatin C expression was investigated. Whether miR-92a can be used as a new diagnostic marker for diabetic lower limb ischemia was further analyzed.Method1.Patients’ selectionFrom May 2012 to Dec 2013,199 cases of patients diagnosed with diabetes were enrolled in this study and grouped according to ankle-brachial index (ABI). The criterion was as follows:patients with ABI 1.30～0.91 was the simple type II diabetes mellitus group (T2DM group, n=60), patients with ABI 0.41～0.90 was the diabetes with mild to moderate lower limb ischemia group (LLI-LM group, n=70) and patients with ABI<0.40 was the diabetes with severe lower limb ischemia group (LLI-S group, n=69). The gender composition of every group was as follows. T2DM group:30 males,30 females; LLI-LM group:40 males,30 females; LLI-S group:38 males,31 females. Moreover,60 healthy outpatients at the same time were randomly selected as the normal control group (NC group), with 32 males and 28 females. Patients with diabetes (screen by the oral glucose tolerance test), hypertension, other endocrine and metabolic diseases, or a family history of diabetes were excluded. All the subjects in the four groups were excluded from conditions including infection, diabetic ketoacidosis, blood system diseases, and a cancer history, and had no history of hormone drug use or surgical stress. Prior written informed consent was obtained from all patients enrolled and the study protocol was approved by the ethical committee of Shangdong Provincial Hospital.2.Patients’ clinical data and biochemical indicesHeight, weight, waist and hip circumference, and systolic and diastolic blood pressure were measured, and the body mass index and waist-hip ratio were calculated thereof. Cystatin C was detected using immune transmission nephelometry (Shanghai Bei Jia Medical Devices Co. Ltd., Shanghai, China). Total cholesterol (TC) was detected by the oxidase method, and triglyceride (TG) by the GPO enzyme method. High density lipoprotein cholesterol (HDL-C) and low density lipoprotein cholesterol (LDL-C) were detected by homogeneous enzyme colorimetry. Fasting plasma glucose (FPG) was measured by the oxidase method. Hemoglobin A1c (HbA1c) was detected by high pressure liquid chromatography (HPLC), and fasting insulin (FINS) by chemiluminescence. Homeostasis model assessment of insulin resistance was employed, with the formula (HOMA-IR)=FINS (mU/L)×FPG (mmol/L)/22.5. Patients’ bilateral limb ABI data were obtained by Philips IU22 Doppler Ultrasound, with ABI equals ankle artery systolic blood pressure/brachial artery systolic blood pressure.This step is to compare the various clinical and biochemical index data of each group, and data analysis, to confirm the correlation between Cystatin C and diabetic ischemia.3. Leukocyte-depleted platelet (LDP) preparation and SYBR Green fluorescence quantitative RT-PCRPeripheral blood samples of each group were taken and citrate dextrose (85 mM trisodium citrate,78 mM citrate,111 mM glucose) was then added, followed by centrifugation at 80 g for 10 min. EDTA (2mM) was added to the platelet-rich plasma (PRP), and platelets were precipitated by centrifugation at 1,000 g for another 10 min. The pellet was resuspended in 3 ml bead buffer (0.8% NaCl,0.02% KCl,0.144% Na2HPO4,0.024% KH2PO4,0.5% BSA, and 2 mM EDTA), and 40μl human CD45 MicroBeads reagent was added, followed by incubation at room temperature for 45 min with gentle mixing. MACS magnetic bead separation system (Miltenyi Biotec, Germany) was employed to separate LDP and obtain platelets with more than 99.99% purity.Total RNAs were extracted using TRIzol reagent according to manufacturers’ instructions. The extracted RNA was reverse transcribed into cDNA with M-MLV reverse transcription kit (Takara, Dalian, China), according to the manufacturer’s instruction. After reverse transcription, fluorescence quantitative RT-PCR was performed. Primer sequences were as follows. Cystatin C Forward: AGATCTACGCTGTGCCTTGG; Cystatin C Reverse: CAGAGCCTGTGGGGTAAACA; miR-92a:ACTATTGCACTTGTCCCG. The reaction system was composed of 12.5 μl SYBR Premix Ex Taq (Takara, Dalian, China),1 μl PCR Forward Primer,1 μl Uni-miR qPCR Primer,2 μl cDNA template, and 8.5 μl ddH2O, with a total volume of 25 μl. Every sample was evaluated in triplicate. The amplification program was set up as follows:pre-denaturation at 95℃ for 30 s, followed by 40 cycles of 95℃ for 5 s, and 60℃ for 20 s. The 2-△△T± SEM was used to calculate relative miRNA expression level.The U6 gene was used as an internal control.This step is to detect the Platelet-derived miR-92a expression level of each group, so as to confirm the miRNA-92a may be related to the severity of diabetic lower limb ischemia.4.Cell culture and transfection and Western blotHuman pulmonary artery endothelial cells were purchased from American Type Culture Collection (ATCC). The cells were cultured in DMEM medium containing 10%FBS and maintained in tissue-culture incubator at 37℃ with an atmosphere of 95% O2/5% CO2. For cell transfection, the pGCMV/EGFP/miR-92a mimic and pGCMV/EGFP/miR-92a inhibitor plasmids were provided by Invitrogen (Carlsbad, CA, USA) and were transfected into the endothelial cells using Liposome 2000 (Invitrogen, Calsbad, CA, USA) according to the manufacturer’s instructions.At 48 h after transfection. the cells were collected and lysed and then centrifuged at 12000 g/min for 5 min at 4℃ and the supernatant was retained. A total of 50 μg protein were used for SDS-PAGE (10%). And then proteins were transferred to PVDF membrane. The membrane was blocked with non-fat milk for 1 h at room temperature. Then primary antibodies of anti-Cystatin C (dilution 1:1000) was added and incubated overnight at 4℃. After washing for three times, HRP-conjugated secondary antibody (dilution 1:2000) was added and incubated for another 2 h at room temperature. ImageLab imaging system (Bio-Rad company, Hercules, California, USA) was used for analysis. β-actin was used as an internal control. Relative levels of Cystatin C protein was calculated based on the levels of P-actin.This step is in order to define the regulation of relationship between miR-92 and Cystatin C.5.Statistical analysisAll preliminary data were tested for normality and processed using the statistical software SPSS 16.0 (SPSS Inc, Chicago, IL, USA). Final data were expressed as mean±standard deviation (x±s). Analysis of variance was used for multi-group comparison, and t test was used for comparison between two groups. P< 0.05 was considered as statistically significant.Results(1) Comparison of clinical data and biochemical indices in each groupTo compare the differences in clinical features, clinical data of each group was compared. Body mass index, waist circumference, and waist-hip ratio of the T2DM, LLI-LM, and LLI-S groups were significantly higher than those of the NC group, respectively (P<0.05). The waist-hip ratio and waist circumference of LLI-S group were significantly higher than those in T2DM and LLI-LM groups (P<0.05), whereas there were no statistically significant difference between T2DM and LLI-LM group. The waist-hip ratio of LLI-S group was significantly higher than that of T2DM group (P<0.05), but not statistically different while compared with that of the LLI-LM group. The systolic blood pressure of LLI-LM and LLI-S groups was significantly higher than that of the NC and T2DM groups (P<0.05), and the value of LLI-S group was the highest. Besides, the difference between the NC and T2DM groups was not statistically significant. The diastolic blood pressure in LLI-S group was the highest among all groups. And, the diastolic blood pressure in T2DM, LLI-LM and LLI-S groups was significantly higher than that in the NC group. Moreover, the diastolic blood pressure in LLI-LM and LLI-S groups was significantly higher than that in the T2DM group (P<0.05), but the difference was not statistically significant between LLI-LM and LLI-S groups. These results showed that compared with T2DM group and LLI-LM group, patients in LLI-S group were with more serious diabetic lower limb ischemia. With an increase in the the degree of ischemia, waist circumference, hip circumference, systolic pressure, body mass index (BMI),and waist hip ratio of diabetic patients gradually increased.Comparison of biochemical indices in each group.To determine the differences in biochemical indices, biochemical indices of each group were tested and compared. As shown in Table 1, FPG, FINS, HOMA-IR, and HbAlC values in T2DM, LLI-LM and LLI-S groups were significantly higher than those in the NC group (P<0.05), and the FINS value in LLI-S group was significantly higher than that of T2DM group (P<0.05). The FINS value in LLI-LM and LLI-S groups was significantly higher than that in T2DM group. HDL-C level in T2DM, LLI-LM and LLI-S groups was significantly lower than that in the NC group (P<0.05). There were no significant differences in levels of FPG, HbAlC and HDL-C among T2DM, LLI-LM and LLI-S groups. LDL-C level in LLI-LM and LLI-S groups was significantly higher than that in NC and T2DM groups (P<0.05), but the difference was not statistically significant between LLI-LM and LLI-S groups. The expression level of Cystatin C in LLI-LM and LLI-S groups was significantly higher than that of the NC and T2DM groups, and it was significantly higher in LLI-S group than in LLI-LM group (P<0.05). The difference of Cystatin C expression was not statistically significant between T2DM and NC groups. Besides, TC and TG values showed no statistically significant difference among each group. The results here showed that Cystatin C expression was closely associated with the level of diabetic lower limb ischemia.(2) Expression of miR-92a in different groupsTo test whether miR-92a expression was changed in each group, fluorescence quantitative RT-PCR was employed to detect the expression of the miR-92a gene in vivo. As shown in Fig.4, it was observed that miR-92a expression in peripheral blood platelets of LLI-LM and LLI-S groups were significantly lower than that in NC and T2DM groups (P<0.05), and miR-92a expression level decreased with the severity of diabetic lower limb ischemia. Moreover, miR-92a expression in LLI-S group was significantly lower than that in LLI-LM group (P<0.05), whereas no significant difference was found in T2DM group when compared with NC group (P>0.05). These results indicated that miR-92a expression level decreased with the severity of diabetic lower limb ischemia.(3) miR-92a suppresses the expression of Cystatin CTo find a miRNA that can regulate Cystatin C expression, bioinformatic analysis and related confirmatory experiments were performed. Three online prediction softwares, miRWalk, miRanda, and Targetscan were utilized to predict the genes that might be involved in regulating the expression of Cystatin C by inputting sequence of Cystatin C gene into these softwares, and miR-92a was suggested to be a candidate. Based on these bioinformatic results, detection of miR-92a expression in platelets was performed subsequently. Considering that platelets would contact with and adhere to endothelial cells in the vascular surface during the atherosclerotic process, we transfected miR-92a analogue and inhibitor into endothelial cells to verify whether miR-92a could regulate Cystatin C at both mRNA and protein levels. Fluorescence quantitative RT-PCR for detecting miR-92a expression was performed to evaluate the transfection efficiency. Compared with that of the NC group, the expression of miR-92a increased by 10.57 times in the miR-92a+mimic group, whereas it reduced by 14.29 times in the miR-92a+inhibitor group.Quantitative RT-PCR and western blot were performed to measure Cystatin C expression at mRNA and protein levels. The expression of Cystatin C at mRNA and protein levels significantly decreased in the miR-92a+mimic group compared with those of the NC group, and both significantly increased in the miR-92a+inhibitor group. These results showed that miR-92a could down-regulate Cystatin C both at mRNA and protein levels.ConclusionIn the present study, we used bioinformatics to predict the genes those regulating Cystatin C, and found that Cystatin C might be the target of a miRNA miR-92a. Transfection of miR-92a into the endothelial cells confirmed that miR-92a could regulate the expression of Cystatin C. This suggests that in the pathological change of atherosclerosis, platelets might release miR-92a directly into endothelial cells through cell-cell interactions and thereby regulate Cystatin C expression. Furthermore, we examined the expression level of miR-92a in platelets of individual patients in the NC, T2DM, LLI-LM, and LLI-S groups, and data analyses demonstrated that the platelet-derived miR-92a was negatively correlated with serum Cystatin C expression in patients. In particular, it was shown that miR-92a expression was very low in platelets in diabetic patients with severe lower limb ischemia, while serum Cystatin C remained a very high level at the same time. This clearly indicates that through combined detection of platelet-derived miR-92a and serum Cystatin C expression, together with the comprehensive evaluation of clinically relevan manifestations, early diagnosis of diabetic lower limb ischemia might be achieved accurately. Early diagnosis of diabetic lower limb ischemia could help to early detection and treatment of lower limb ischemic disease, thus reducing the risk. |
PDF Full Text Request