In our country,cotton is an important economic crop,which plays a crucial role in domestic economy.Excessive weed seriously affects the yield and quality of cotton,and chemical weed control is an effective way to reduce the costs and improve the economic benefits.Glyphosate is a non-selective herbicide with the advantages of broad-spectrum effect,high efficiency,low toxicity and no residual.However,it could also damage the crops when it killed the weeds in the field.Via genetic engineering technology to cultivate and promote the glyphosate-resistant cotton varieties is a great way to engage glyphosate-weed control in field.At present,the domestic herbicide-resistant cotton,which could be used for commercial production,has not been reported.Hence,the herbicide-resistant cotton with independent intellectual property rights is necessary for our cotton industry.In this study,glyphosate-resistant G2-aroA gene with independent intellectual property right was introduced into upland cotton cultivar,using K312 as the receptors by Agrobacterium-mediated transformation,and several glyphosate-resistant transgenic cotton lines were obtained.Meanwhile,the resistance identification and molecular biological analysis about them provided a scientific basis for breeding and commercial production in the future.The specific results in this study are as follows.1.Development of transgenic glyphosate-resistant cottonThe G2-aroA gene driven by Rubisco small subunit gene promoter derived from chrysanthemum wasintroduced into the upland cotton through Agrobacterium-mediated transformation using K312hypocotyls as explants and Kanamycin as screening agent.10 T0 transformed cases were obtained and were able to flower normally and fruit.G2-aroA gene has been integrated into cotton genome,which was confirmed by kanamycin and glyphosate screening and molecular biology detection such as PCR,Southern Blot hybridization,respectively.2.Genetic analysis of transgenic cotton progenyThe T1 lines were planted from the T0 self-crossed seeds.The separation and distribution of the kanamycin-resistant trait in T1 showed that the transformants were consistent with 3:1 ratio,according to?2 test and molecular biology detection.3.Glyphosate resistance test of transgenic cottonThe cottons were treated with 0‰,1‰,2‰,4‰,8‰and 10‰of the glyphosate effective concentration by spraying on the whole plant.Wild-type K312 is highly sensitive to glyphosate herbicide,and the plants were died even treated by 2‰glyphosate which was the recommended concentration of application in field.While the transgenic cotton BG2-7 showed no significant effect with the treatment of 2‰glyphosate.With the increase of the concentration of glyphosate,the vulnerability of transgenic cotton growth inhibition turn up gradually,and the cotton with 10‰concentration of glyphosate treatment which was five times the recommended amount was still able to grow slowly and to flower normally and fruit.The results of glyphosate-resistance test showed that the transgenic cotton BG2-7 had a high resistance to glyphosate.4.Analysis of the exogenous gene integrated structure of transgenic cotton BG2-7By TAIL-PCR and standard PCR,the inserted fragment flanking integrated structure in transgenic cotton BG2-7 was obtained.The exogenous gene is inserted into the cotton genome eleventh chromosome,and its 5'end is located at the site of 61,253,333 of the chromosome.There are 31 bp cotton microsatellite sequence between cotton genome sequence and the exogenous gene 5'end.The 84bp nucleotide was deleted at the left boder of the exogenous,and 298 bp base was deleted at its right boder,and the chromosome was deleted 30 bp nucleotide at the insertion site.5.Establishing the event-specific detection of transgenic cotton BG2-7According to the flanking sequence information we obtained,several pairs of event-specific detection primers were designed between the exogenous gene 5'end and cotton genome junction region and between the 3'end and cotton genome junction region.By screening tests,the primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and the primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the BG2-7event-specific primers,respectively.The detection limitation of the previous primers can reach 44copies,and the detection limitation of the latter primers can reach 88 copies.And according to the flanking sequence information,a group of multiplex PCR primers were determined for thePCRdetection.TheprimersATGGAAGGGCTGTTGATACA/TCTGACATCATGGATCGCAA were used to colon the cotton genome sequence and the primers TCGCTTTCTTCCCTTCCTTT/TCTGACATCATGGATCGCAA were used to determine the 3?end specific sequences.Therefore,the PCR screening method to determine the transformation event homozygous was established. |