The Regulation Mechanism Of MiR-26b On Porcine Granulosa Cell Apoptosis

MicroRNAs (miRNAs) are small non-coding RNA molecules (containing about 22-25 nucleotides) that regulate gene expression in the posttranscriptional level. miR-26b, one of the current most studies miRNAs, is extensively involved in cell proliferation, apoptosis,differentiation, migration, autophagy and many other cellular processes. In porcine ovarian tissue,our. previous research showed that miR-26b was up-regulated in the process of follicular atresia and promotes porcine granulosa cell (pGC) apoptosis. However, the characteristics of porcine miR-26b precursor gene are not known until now, and its regulatory mechanism in the pGC apoptosis process is also unknown. In this study,we obtained the sequences of porcine miR-26b gene through cloning and sequencing.Bioinformatics was used for analysis of miR-26b precursor sequences. The function of miR-26b on the regulation of pGC apoptosis was predicted by bioinformatics and confirmed by experiments. Using bioinformatics methods and various technologies to identify target genes of miR-26b and analyze the signaling pathway in the pGC apoptosis controlled by miR-26b. That provied evidence for analysis the regulation of miR-26b in porcine follicular and pGC apoptosis.The results of this study consist of the following aspects:1 Cloning and sequences analysis of pig miR-26b precursor geneWe obtained the 85bp miR-26b precursor gene sequence by amplification and sequencing with pig genomic DNA as a template. The miR-26b precursor gene is highly conserved with other species of mammals. The mature sequence of pig miR-26b is UUCAAGUAAUUCAGGAUAGGU, which is completely consistent with that in other mammals,while mature miR-26b in Actinopterygii contains a U→C mutation at nucleotide 11. Meanwhile, the seed region (UCAAGUA) of miR-26b is conserved among vertebrate species. The second structure of mir-26b precursor is a typical hairpin predicted using RNAfold software. In addition, we identified four asymmetric bulges in the structure of ssc-miR-26b duplexes, which may affect the initiation of transitivity. Therefore, we speculated that the precursor and mature sequences of miR-26b are highly conserved and have similar functions in different species.miR-26b participates in multiple signaling pathways, mainly concentrated in the apoptosis, PI3K/AKT, Foxo and TGF-β pathway by KEGG pathway analysis. Moreover,the most target genen of miR-26b in the apoptosis related pathway, indicating miR-26b is an apoptosis-related miRNA. Annexin v FITC/PI flow cytometry results showed a significantly increase of pGC apoptosis after miR-26b treatment. In addition, the expression of anti-apoptosis gene Bcl-2 was inhibited. Therefore, miR-26b has a pro-apoptosis effect on the pGCs.2 miR-26b regulates pGC apoptosis by targeting USP9X geneUSP9X is one of the candidate target genes of miR-26b predicted by bioinformatics analysis. Luciferase activity analysis showed that miR-26b could significantly inhibit USP9X-3’UTR luciferase activity, but no effect on the mutant USP9X-3’UTR luciferase activity. The results indicated that miR-26b can directly bind USP9X gene 3’UTR and inhibit the expression of USP9X. In pGC, cultured in vitro, the mRNA and protein expression levels of USP9X gene significantly reduced by miR-26b, indicating USP9X was target regulated by miR-26b. Knockdown USP9X can significantly increase the apoptosis rate of pGC and the pro-apoptotic gene Bax mRNA expression, and reduce the anti-apoptotic gene Bcl-2 mRNA expression, which indicating USP9X inhibits apoptosis in pGC.Previous research found that Samd4 is a downstream gene of USP9X and the degradation of SMAD4 was reduced by USP9X ubiquitination, which enhances its biological function. In this thesis, we further analyzed the regulation mechanism of USP9X in pGC. There were no significantly changes in SMAD4 mRNA expression after USP9X knockdown by USP9X-siRNA, however, the level of SMAD4 protein was significantly lower compared with the controlling group, indicating that USP9X promotes the SMAD4 protein expression in pGC. Moreover, overexpression of SMAD4 promotes the proliferation of pGC and knockdown SMAD4 may cause pGC apoptosis. In addition,overexpression or inhibition of miR-26b significantly inhibits or promotes the expression of SMAD4 in pGC, respectively, indicating that miR-26b regulates GC apoptosis by USSP9X-SMAD4 axis. Meanwhile, the ligand of TGF-β/SMAD signling is also involved in miR-26b-USP9X-SMAD4 signaling in pGC. Interesting, we found that have the SBE(Smad binding sites) in the promoter of CYP19A1 gene. The luciferase activity analysis found that overexpression or knockdown SMAD4 promotes or inhibits the activity of CYP19A1 promoter, respectively. To sum up, we issued a new regulation pathway of apoptosis in porcine granulosa cells, namely miR-26b-USP9X-SMAD4-CYP19A1 signaling pathway. At last, we found that the TGF-β/Smad signaling pathway ligand,TGF-β1, is involved in the miR-26b-USP9X-SMAD4-CYP19A1 signaling pathway.3 miR-26b regulates apoptosis in pGC by targeting HAS2Early study in our lab found that miR-26b can regulate apoptosis in pGC by targeting HAS2. Here, we further confirmed miR-26b could directly bind the HAS2-3’UTR using bioinformatics analysis andpoint mutation luciferase report system. qRT-PCR and Western blot found that the mRNA and protein expression of HAS2 was significantly or extremely significantly higher in the healthy pig follicles than the atretic follicles, respectively, which indicating HAS2 may be involved in the regulation of porcine follicular atresia.Knockdown of HAS2 significantly increased apoptosis in pGC. While overexpress HAS2 exhibited an opposite effect. In addition, co-transfection miR-26b inhibitor and HAS2-siRNA in pGC could significantly increase apoptosis in pGC, therefore miR-26b could regulate pGC apoptosis by targeting HAS2.HAS2 is the key synthesis enzyme of HA and inhibits granulosa cell apoptosis by activating CD44 and inhibiting Caspase-3 expression. In this paper, we further analyzed the regulation pathway of miR-26b in pGC apoptosis by targeting HAS2. Knockdown and overexpression of miR-26b increased and decreased HA content, and HAS2 and CD44 expression respectively, in pGCs. At the same time, inhibition or overexpression of miR-26b decreased or increased the expression of Caspase-3, a downstream factor in the HAS2-HA-CD44 pathway, which indicating miR-26b could regulate HA-Caspase-3 pathway by targeting HAS2. Supplement of HA in pGC significantly influenced the expression of CD44 and Caspase-3 and reduced the apoptosis of pGC. Moreover, HA rescued apoptosis of pGC through HAS2-siRNA and miR-26b related pathway. All the results illustrated that miR-26b regulates pGC apoptosis by HAS2-HA-CD44-Caspase-3 pathway.In General, in this thesis we obtained the pig miR-26b precursor gene sequences and confirmed it is a pro-apoptosis factor in pGC. USP9X and HAS2 are the direct target genes of miR-26b in pGC. Moreover, miR-26b regulates apoptosis in pGC through USP9X-SMAD4-CYP19A1 signaling pathway and HAS2-HA-CD44-Caspase-3 signaling pathways. Hence, we found two new regulation pathways in the process of porcine follicular atresia and granulosa cells apoptosis: miR-26b-USP9X-SMAD4-CYP19A1 pathway and miR-26b-HAS2-CD44-Caspase-3 pathway.