Effects Of Pravastatin On Abdominal Aortic Aneurysm And The Underlying Mechanisms

1 IntruductionAbdominal aortic aneurysm(AAA)is a common,potentially life-threatening,chronic vascular degenerative disease with over 85%mortality after rupture.AAA is found in up to 6-9%of men over 65 years old claiming more than 15,000 lives annually.Currently,there are no therapeutic strategies but surgery proven to blunt AAA progression and rapture.The rising prevalence of AAAs,coupled with the high mortality from ruptured AAA,clearly supports the need for research to define novel risk factors for preventing AAA initiation,progression,and rapture in patients.Pathologically,AAA is characterized by dilatation of all layers of the arterial wall as a result of loss of elastin,vascular smooth muscle cell(VSMC)apoptosis,and compensatory collagen deposition.Inflammation and matrix degradation in the vasculature are crucial for AAA formation.For example,angiotensin ? increases matrix metalloproteinases(MMPs)to induce AAA formation in animal experiments by upregulating oxidative stress.Statins,as HMG-CoA reductase inhibitors,are cholesterol-lowering drugs and widely used in the treatment of hypercholesterolemia to prevent the development of atherosclerosis through improving endothelial function,preventing the adhesion of monocytes,or suppressing VSMC proliferations.Statins also produce several adverse effects,such as insulin resistance,skeletal muscle toxicity and myocardial atrophy.However,the effects of statins on AAA incidence remains highly controversial.For example,pravastatin at low dose inhibited cerebral aneurysm formation,while it promoted cerebral aneurysmal growth at high dose.Differently,simvastatin inhibited AAA formation induced by angiotensin ?(Ang?)in apolipoprotein E knockout(Apoe-/-)mice.Both rosuvastatin and atorvastatin had no benefit for abdominal aortic aneurysms.The AMP-activated protein kinase(AMPK),consisting of catalytic a subunit and regulatory subunits ? and ?,has a pivotal function in energy homoeostasis in eukaryotes.We reported that AMPK activation mediated nicotine-induced AAA formation in Apoe-/-mice.AMPK is activated by pravastatin in skeletal muscle and endothelial cells.This alludes that pravastatin is potentially to promote AAA incidences.Activator protein 2a(AP-2a)is a member of the AP-2 transcription factor family consisting of ?,?,?,?,and ? subunits.Mice deficient in AP-2 die after birth due to the abnormal development,suggesting an important role of AP-2 in mammals.Park et al reported that nerve growth factor stimulated endothelial cell invasion by augmenting MMP-2 via AP-2?-dependent gene transcription,which may be responsible for triggering angiogenesis.We have previously reported that AMPKa2 performs the upstream kinase to phosphorylate AP-2a protein at serine 219(pAP-2a-S219)in VSMCs.We found that aspirin activates AMPK to increase AP-2a in accelerated the stability of vulnerable atherosclerotic plaque.At present,the main experimental animal model of AAA is induced by continuous infusion of Angll for 4 weeks in Apoe-/-mice.In the present study,we sought to explore the effects of pravastatin on Ang ?-induced AAA in Apoe-/-mice and to elaborate the possible mechanisms regulating these effects.2 Objectives(1)To assess the effects of pravastatin on Angll-induced AAA in Apoe-/-mice.(2)To explore the possible molecular mechanism of pravastatin-worsened AAA formation in Angll-infused Apoe-/-mice.3 Methods3.1 Generation of shRNA construct and lentivirus production Based on the protocol from Signaling Gateway,the shRNA cassette containing target sequence of AMPKa2(GGAGAGCUAUUUGAUUAUATT)or AP-2a(GGAGAGCGAAGTCTAAGAATG)was designed.3.2 Animal protocolsThere are four parts of the in vivo study.The first part was to assess the effects of pravastatin on Angll-induced AAA in Apoe-/-mice.Sixty-one male Apoe-/-mice(20-25 g body weight)aged 8-12 weeks on a C57BL/6J background were received pravastatin administration(50 mg/kg)in drinking water for 4 weeks.The model of AAA was established by implanting an Alzet osmatic minipumps(Model 2004,Durect Corporation,CA,USA)into Apoe-/-mice to deliver Ang? subcutaneously at a dose of 1.44 mg/kg/day or saline vehicle for 28 days as described previously.Ang?-infused mice were also received pravastatin administration for another 4 weeks.At the end of experiment,all mice were sacrificed under anesthesia.The second or third part was to elaborate the role of AMPK or AP-2a in the effects of pravastatin on Ang ?-induced AAA.Ninety male Apoe-/-mice(20-25 g body weight)at age of 8-12 weeks were received pravastatin administration(50 mg/kg per day)in drinking water.After 4 weeks,mice were infected with GFP-labeled lentivirus containing scramble shRNA,AP-2a or AMPKa shRNA via tail vein injection as described previously with light modifications and infused with Angll using an Alzet osmatic minipumps at the dose of 1.44 mg/kg/day.All mice also received pravastatin administration(50 mg/kg/day)in drinking water for 28 days.At the end of experiment,all mice were sacrificed under anesthesia.The forth part was to assess the effects of simvastatin and mevalonate on Ang?-induced AAA in Apoe-/-mice.Seventy-seven male Apoe-/-mice(20-25 g body weight)at age of 8-12 weeks were received pravastatin(50 mg/kg/day)in drinking water,simvastatin(50 mg/kg/day)via intragastric administration,mevalonate(2 mg/kg/day)via intraperitoneal injection or plus pravastatin in drinking water for 4 weeks.Then mice were infused with Angll using an Alzet osmatic minipumps at the dose of 1.44 mg/kg/day for another 28 days.All mice also received drug administration for 28 days.At the end of experiment,all mice were sacrificed under anesthesia.3.3 Histology and morphologyAt the end of the experiment,animals were sacrificed.The whole aortas including thoracic and abdominal aortas were collected for morphological and histological analysis of AAA.To quantify AAA incidence and size,the maximum width of the abdominal aorta was measured with Image Pro Plus software.Aneurysm incidence was quantified based on a definition of an external width of the suprarenal aorta that was increased by 50%or greater compared with aortas from saline-infused mice.The whole aortas were harvested,fixed for 24 h,embedded in paraffin,and cross-sections(4.5 pm)were prepared.Aortic sections of different groups were stained by hematoxylin and eosin for morphological assessment.Elastic fiber integrity of the abdominal aorta was visualized by use of a Verhoeff-Van Gieson staining kit(Gemed Scientific Inc.,USA)according to manufacturer's instruction.Immunohistochemistry involved use of the primary antibody to detect smooth muscle cells(a-SM actin),MMP-2,MMP-9,4-hydroxynonenal(4-HNE),and p47phox(P47).Immunofluorescence was performed involving the detection of GFP,AMPK,and AP-2a.3.4 Cell cultures and treatmentsMouse and human vascular smooth muscle cells(VSMCs)from ATCC were used between passages 4 and 8.(1)Murine VSMCs were treated with pravastatin for 2 hours as indicated concentrations.(2)Cultured VSMCs were pretreated with tempol(10 ?M,30 minutes)followed by co-incubation of pravastatin(50 pM)for 2 hours.(3)Murine VSMCs were pretreated with compound C(20 pM,30 minutes)followed by co-incubation of pravastatin(50 pM)for 2 hours.(4)Murine VSMCs transfected with AMPKa2 siRNA or AP-2a siRNA for 48 hours were incubated with pravastatin(50 ?M)for 24 hours.(5)Murine and human VSMCs were treated with pravastatin(50 ?M)for 30 minutes followed by Angll(1 ?M)for 24 hours.(6)Murine and human VSMCs were treated with pravastatin(50 ?M),simvastatin(10 ?M)and mevalonate(100 ?M)for 30 minutes followed by Angll(1 ?M)for 24 hours.3.5 Detection of ROSROS production in murine VSMCs was measured using the fluorescent probe DHE.3.6 Western blot analysisTotal proteins were extracted from the aortas of Apoe-/-mice or VSMCs.Western blot was performed to detect the protein expression of pAMPK,AMPK,pAP-2?,AP-2?,MMP-2,MMP-9,NOX4,4-HNE,and P47.3.7 RT-PCRTotal RNA was isolated from the aortas of Apoe-/-mice or VSMCs.In in vivo or in vitro experiment,mRNA expression of MMP-2 and MMP-9 was determined,with ?-actin as an internal control.3.8 ZymographyThe MMP-2 activity in the mice aortas and cell culture medium were was measured by use of a MMP gelatin zymography kit?3.9 ELISASerum concentration of MMP2 was determined by using human MMP2 enzyme-link immunosorbent assay(ELISA)kit following the manufacturer's recommendations.3.10 Patients and samples processingAAA tissues were obtained from human subjects under surgery.Abdominal aortic lesions were confirmed by aortic morphological analysis whereas control aortic tissues were found to have no aortic diseases.The blood was collected from human subjects before and after pravastatin treatment.Leucocytes were isolated from blood and subjected to Western blot analysis for the expression and phosphorylation of AMPK?2 and AP-2?.4 Results4.1 Blood pressureAng ? infusion significantly increased blood pressure in Apoe-/-mice compared with saline treatment.However,neither pravastatin nor mevalonate and simvastatin had effect on SBP.4.2 Serum lipidPravastatin and simvastatin treatment significantly increased the levels of TC and LDL-H in Apoe-/-mice.4.3 Pravastatin promotes the incidence and severity of AAA formation in Angll-infused Apoe-/-miceAt the end of the study,the incidence of AAA was 26.67%,53.33%,60.87%and 91.30%in Ang(0.72)Vehicle,Ang(0.72)pravastatin,Ang(1.44)Vehicle and Ang(1.44)pravastatin groups,respectively,and the mortality was 0.00%,13.33%,21.74%and 47.82%.Both doses dramatically induced the formation of AAA,in which the effects of Angll at 1.44 mg/kg/day were stronger than 0.72 mg/kg/day on AAA formations.Pravastatin significantly boosted the Angll-induced AAA formation by increased AAA incidence,severity and mortality.Histological analysis also indicated that the maximal aortic diameter and the degradation of elastin were increased by pravastatin in Apoe-/-mice infused with Angll.Interestingly,the effects of pravastatin on increasing AAA formation in Angll at dose of 0.72 mg/kg/day were more obvious than Ang? at 1.44 mg/kg/day.These results suggest that pravastatin promotes the Ang?-induced AAA formation in Apoe-/-mice.4.4 H&E and Verhoff stainingH&E and Verhoff staining revealed that Ang ? infusion incuced vascular remodeling,including breakdown of the aortic media and adventitia,hypertrophy of the adventitia,weakening and dilation of the aortic wall and luminal thrombosis in Apoe-/-mice.Pravastatin treatment could aggravate these pathological changes induced by Ang ?.4.5 Pravastatin via ROS increases AMPK phosphorylation in VSMCsThe levels of pAMPK-T172 were gradually increased by pravastatin in concentration-dependent manner in cultured murine VSMCs.Tempol,as a SOD mimic,abolished the augments of Nox4,p47,4-HNE,and pAMPK-T172 induced by pravastatin.Similarly,the ROS productions,assayed by determining the intensity of DHE fluorescence,were increased by pravastatin,which were abolished by tempol4.6 Pravastatin via ROS enhances AP-2a phosphorylation in VSMCsPravastatin did not increase the level of pAP-2a-S219 at a concentration of 0.1-1 ?M;however,at 10 ?M,pravastatin significantly enhanced AP-2?S219 phosphorylation.Increasing concentrations of pravastatin(50-100 ?M)further enhanced AP-2? phosphorylation.Further,reduction of ROS by tempol abolished pravastatin-induced AP-2? S219 phosphorylation,revealing that pravastatin is a potential activator of AP-2a through ROS.4.7 AMPK?2 is involved in pravastatin-increased AP-2a phosphorylationPravastatin for 2 hours enhanced AP-2? phosphorylation in vehicle-treated cells,but not in VSMCs pretreated with compound C.The effects of compound C on AP-2? phosphorylation were further confirmed by transfecting VSMCs with AMPK?2 siRNA to inhibit AMPKa2 expression.AMPKa2 siRNA,but not control siRNA,blocked the effects of pravastatin on AP-2? phosphorylation4.8 Pravastatin via AMPK?2 and AP-2? upregulates MMP2 in murine VSMCsPravastatin concentration-dependently increased the protein levels of MMP2 in VSMCs.Tempol and compound C significantly abolished the pravastatin-enhanced the levels of MMP2 protein and activity,as well as MMP2 mRNA,Furthermore,endogenous expressions of AMPKa2 and AP-2?in VSMCs were suppressed by AMPK?2 and AP-2? siRNA.Deficiency of AP-? had no effects on pravastatin-increased AMPK phosphorylation,indicating that AP-2? is a downstream of AMPK.Pravastatin increased the levels of MMP2 protein,mRNA and activity in cells transfected with control siRNA,but not in cells transfected with AMPKa2 and AP-2a,4.9 Pravastatin activates AMPK?2/AP-2?/MMP2 signaling in Ang?-treated murine VSMCsBoth Angll and pravastatin alone increased the levels of pAMPK,pAP-2?,and MMP2 protein and mRNA expressions in VSMCs.Importantly,co-incubation of pravastatin further increased the levels of pAMPK,pAP-2a,and MMP2 protein and mRNA expressions in Angll-treated VSMCs.4.10 Pravastatin activates AMPKa2/AP-2a/MMP2 signaling in Angll-treated human VSMCsTo show the translational applicability of these observations from mice,we also tested whether they can be replicated in human VSMCs.Thus,primary human aortic VSMCs were incubated with Angll plus pravastatin.Similarly,pravastatin increased the levels of pAMPK,pAP-2a,and MMP2 protein and mRNA expressions in human VSMCs with or without Angll.4.11 Knockdown of AMPKa2 ablates pravastatin-enhanced AAA formation in Apoe-/-miceLentivirus-mediated RNA interference significantly inhibited AMPK?2 protein expression in abdominal aortic artery.Similarly,pravastatin treatment significantly accelerated the Angll-induced AAA formation in Apoe-/-mice infected with lentivirus expressing scramble shRNA.The incidence and mortality of AAA,maximal diameter,and elastin degradation in abdominal aortic artery were increased,compared to vehicle-treated mice.However,all these effects induced by pravastatin were limited in Apoe-/-mice if they were infected with lentivirus expressing AP-2? shRNA.4.12 Lentivirus-mediated gene knockdown of AP-2a abolishes the effects of pravastatin on AAA formation in Apoe-/-miceWe generated AP-2?-knockdown mice by infecting lentivirus containing AP-2a short hairpin RNA(shRNA)to downregulate AP-2? protein expression in Apoe-/-mice.Pravastatin significantly promoted the Ang?-induced AAA formation in Apoe-/-mice infected with lentivirus expressing negative control shRNA,but not in Apoe-/-mice infected with lentivirus containing AP-2?shRNA.4.13 Pravastatin-activated AMPK?2/AP-2?/MMP2 signaling is not mimicked by simvastatin and is not abolished by mevalonate in VSMCs Different to pravastatin,simvastatin did not increase the levels of pAMPK,pAP-2a and MMP2 expression in VSMCs treated with Angll.Moreover,the increased levels of pAMPK,pAP-2? and MMP2 produced by pravastatin were not inhibited by mevalonate supplementation.4.14 Simvastatin does not promote Angll-induced AAA formation Compared to pravastatin,simvastatin had no any effects on Angll-induced AAA formations,including AAA incidences,maximal aortic diameter,and the degradation of elastin,as well as MMP2 expressions.4.15 Pravastatin-increased AAA formations were not reversed by mevalonateMevalonate alone had no any effects on Angll-induced AAA formation.Furthermore,mevalonate supplementations did not inhibit the effects of pravastatin on AAA formation,4.16 Increased AP-2? and AMPK?2 phosphorylations in AAA patients Human AAA samples exhibited higher levels of AMPK?2 and AP-2?phosphorylations in aortic tissues from AAA than those from non-AAA control patients.4.17 Pravastatin increases AP-2? and AMPK?2 phosphorylations in humansThe levels of pAP-2?-S219 and pAMPK-T172 were remarkably increased by taking pravastatin in humans,accompanied with the enhancement of serum MMP2 levels5 Conclusions(1)Pravastatin significantly increased the AAA incidence,the mortality and the severity of AAA in Ang?-infused mice.(2)Pravastatin induces oxidative stress to increase AMPK-dependent AP-2?S219 phosphorylation,resulting in the activation of AP-2? transcriptional activity.(3)Pravastatin increases AAA incidences through AMPK?2/AP-2?/MMP-2 signaling but independent of HMG-CoA reductase1 IntruductionAdriamycin is a commonly used chemotherapeutic agent for the treatment of solid and haematologic tumors.However,its cardiotoxic side effects and the development of severe congestive heart failure limit the application of thispotent chemotherapeutic agent.The mechanisms of adriamycin-induced cardiomyopathy remain not fully elucidated.Pathologically,adriamycin-induced cardiomyopathy was associated with heightened oxidative stress status,apoptosis of cardiac cells,inflammatory response,myocardial fibrosis,metabolism abnormality,DNA damage and mitochondrial damage.Several agents including anti-oxidants,angiotensin converting enzyme inhibitors(ACEI),angiotensin receptor antagonists(ARB)and dexrazoxan have been employed for the attenuation of adriamycin-induced cardiomyopathic damage.Unfortunately,all of these agents have not yet gained effective enough evidence to justify a routine use.Hence,the search for a safe and effective therapeutic method of preventing adriamycin-induced cardiomyopathy remains an important issue in both cardiology and oncology.The renin-angiotensin system(RAS)plays an important role in the pathophysiology of adriamycin-induced cardiomyopathy,and the inhibition of ACE/Angll/Angll type 1(AT1)receptor(AT1R)axis has been shown to improve adriamycin-induced cardiomyopathy.Traditionally,ACEI and ARB are involved in inhibiting the synthesis of Angll and preventing activation of AT1R.However,the degradation of Angll may also function as regulating Angll levels,especially at a tissue level.ACE2 is considered a potential therapeutic target of RAS for the treatment of cardiovascular diseases due to its key role in limiting the vasoconstrictor action of Angll through its inactivation,and counteracting the actions of Angll through the formation of Ang(1-7),which is reported to have prevented left ventricular fibrosis and dysfunction at the Ang(1-7)or mas receptor.Crackower et al.first reported a severe myocardial contractile dysfunction in ACE2-knockout mice.Our previous study found that ACE2 overexpression attenuated myocardial collagen accumulation and improved left ventricular remodeling and function in a rat model of myocardial infarction.Other studies also reported that ACE2/Ang(1-7)axis played a role in cardiac physiology and in the pathophysiology of heart failure.ACE2,a homologue of ACE,catalyzes conversion of Angl to the inactive nonapeptide Ang(1-9)and conversion of Angll to a vasodilative heptapeptide Ang(1-7),thereby functioning effectively as an endogenous ACE inhibitor.We took the approach of direct injection of ACE2 adenoviral vectors into heart in the current study.Although intramyocardial injection of ACE2 adenoviral vectors may induce myocardial damage when compared with oral drugs,little study has been reported about the direct effects of ACE2 gene overexpression on adriamycin-induced cardiomyopathy.Therefore,we determined the effects of ACE2 overexpression via an adenovirus vector or ACEI on adriamycin-induced cardiomyopathy and to elaborate the possible mechanism mediating these effects.2 Objectives(1)To establish animal models of cardiomyopathy in rat induced by adriamycin.(2)To assess the effects of ACE2 overexpression or cilazapril on ACM in rat.(3)To explore the possible molecular mechanism involved in ACE2 overexpression protection against ACM in rat.3 Methods3.1 Preparation of ACE2 adenovirus vectorsThe murine ACE2 cDNA was amplifed by reversetranscription polymerase chain reaction(RT-PCR)from RNA of a mouse kidney with the following primers:ACE2 F:5'-GAAAGTTGCTCAGTGGATGGGAT-3';R:5'-TTTGCTAAAAGGAAGTCTGAGCATC-3'.First,the amplified product was cloned into a pMD18-T vector,and then sub-cloned into pDC316.The ACE2 cDNA sequence in the pDC316-ACE2 plasmid was confirmed by sequencing.Recombinant adenoviruses(Ad)carrying the murine ACE2(Ad-ACE2)or a control transgene EGFP(AdEGFP)were prepared with the AdMax system(Microbix Biosystems)according to our previously described experimental method.3.2 Animal models of adriamycin-induced cardiomyopathy and gene treatment.All rats were randomly divided into treatment group(n=170)and control group(n=20).Adriamycin was injected intraperitoneally via six equal doses(each containing 2.5mg/kg Adriamycin)within a period of two weeks,as previously described.Age-matched rats injected with saline were used as control.Two weeks after the initial injection of adriamycin,the remaining rats in the treatment group were randomly divided into Mock,Ad-EGFP,Ad-ACE2,and Cilazapril groups(n=40 each group).As shown in Figure 10,rats in the Ad-EGFP and Ad-ACE2 groups were anesthetized with an intraperitoneal injection of 10%chloral hydrate(300mg/kg)and mechanically ventilated with a VIP Bird ventilator with a tidal volume,3.0 ml and respiratory rate of 60 cycles/min.Anterior thoracotomy was performed under sterile conditions to open the pericardium and expose the heart.A total of 2×109 pfu of Ad-EGFP and 2×109 pfu of Ad-ACE2 in a final volume of 200?l was delivered by a 30-gauge needle into six sites at depth of 1-2 mm in the left ventricular free wall as previously described.The Mock group underwent the same surgical procedure but received an intramyocardial injection of normal saline only.The Cilazapril group was given cilazapril by intragastric intubation at a dose of 10 mg·kg-1·d-1.Two weeks after adenovirus injection,eight rats from each group were euthanized for assessing the efficiency of Ad-ACE2 transfection,and the remaining rats in the treatment and control groups were euthanized 4 weeks after gene therapy.The myocardium of the left ventricle was collected for pathological and biochemical analysis.3.3 Blood pressure measurementHeart rate,systolic blood pressure and diastolic blood pressure were measured in conscious rats using a noninvasive tail-cuff system with a special device designed for mice.Blood pressures and heart rates were reported as mean of 3 consecutive measurements.3.4 Echocardiographic imagingAt the end of experiment,rats in the five groups underwent transthoracic echocardiographic scanning after anesthesia with intraperitoneal injection of 10%chloral hydrate(300mg/kg),and two-dimensional echocardiography was performed with a 7.5-MHz phased-array transducer connected to a sector scanner.The left ventricular end-diastolic diameter(LVEDD)and left ventricular end-systolic diameter(LVESD)were obtained from the parasternal long-axis view and the left ventricular fractional shortening was calculated according to the following formula:FS =(LVDd-LVDs)/LVDd x 100.Left ventricular ejection fraction(LVEF)was calculated according to the following formula:LVEF =(LWd-LWs)/LWd × 100.3.5 RT-PCRTotal RNA was isolated from rat myocardium,RT-PCR was performed to detect mRNA expression of ACE2.3.6 Western blot analysisTotal proteins were extracted from rat myocardium.Western blot was performed to detect the protein expression of ACE2,ACE,Collegern ?,Collegen?,ICAM-1,VCAM-1,TNF-a,AMPK,ERK,PI3K,AKT,Bcl-2,Caspase-3,TGF-?1,MMP-1,MMP-9,TIMP-1,TIMP-2.3.7 HistopathologyAfter being fixed in formalin and embedded in paraffin,tissue samples from the myocardium were cut into serial sections 4.5pm thick and stained with hematoxylin-eosin.The sections were stained with Masson's trichrome to display the collagen components,which were quantitated by measuring the proportion of area positively stained with Masson's trichrome to the total left ventricular area in the section.Immunohistochemical staining was used to determine the expression of ACE2,collagen I and III,VCAM-1 and TNF-a,respectively.3.8 TUNEL assayTUNE-L assay was performed using an Roche in situ cell death detection kit,POD according to the manufacturer's instructions.Briefly,the sections were dewaxed and rehydrated using xylene and ethanol gradings,permeabilized using proteinase K and incubated with the TUNEL reaction mixture containing TdT and fluorescein labeled dUTP for 1 hour at 37?.Sections were washed by PBS for 3 times and incubated with the converter-POD for 30mins at 37? followed by DAB+ chromogen detection.After final washes,sections were counterstained with hematoxylin.Images were captured with a microscope and with digital camera.For negative control,TdT was not included in the reaction mixture.The TUNEL-positive cells were quantified by randomly counting 12 different microscopic fields for each section.Then the ratio of apoptotic cells was calculated by dividing the number of TUNEL-positive nuclei by the total number of counted nuclei.3.9 Angll and Ang(1-7)levels by ELISAThe concentration of Angll and Ang(1-7)in the rat myocardium and plasma was determined by using commercial enzyme-linked immunosorbent assay(ELISA)kits following the manufacturer's recommendations.In brief,the myocardium had been frozen and powdered in liquid nitrogen,the powdered tissue was mechanically homogenized with Iscove's culture medium containing a protease inhibitor cocktailon ice,using a homogenizer.Homogenized samples were centrifuged at 10,000 rpm for 10 min at4?.Each supernatant was then transferred into a fresh eppendorf-tube and stored at-80?.Blood was obtained in a cocktail of protease inhibitors,and the levels of myocardial and plasma Angll and Ang(1-7)were determined by ELISA.3.10 ACE2 activity assay.ACE2 activity was determined by use of assays based on internally quenched fluorescent substrates[7-Mca-YVADAPK(Dnp)-OH]for ACE2 activity.3.11 Measurements of SOD assayThe SOD activity in the heart was measured according to the method using a kit.Tetrazolium salt can be made to form a red formazan dye by superoxide radicals generated by xanthine oxidase and hypoxanthine.The red formazan dye was measured and evaluated at the optical density of 550 nm by a spectrophotometer.The SOD activity was expressed as IU/mg protein.4 Results4.1 General observations and mortalityWe found that rats in the Mock and Ad-EGFP groups developed scruffy,light yellowish fur,diarrhea and red exudates around the eyes with grossly enlarged abdomen and ascites.In contrast,rate in the Ad-ACE2 group showed no diarrhea,eye discharge,or ascites,while rats in the Cilazapril group had slight symptoms above.23 of Mock group rats,24 of Ad-EGFP group rats,6 of Ad-ACE2 group rats and 15 of Cilazapril group rats died in the 4-week period following the completion of the treatment with adriamycin,yielding a cumulative mortality of 71.88%,75.00%,18.75%and 46.88%,respectively.No death was found in the control group.The mortality of rats in Ad-ACE2 and Cilazapril groups was significantly lower than that in the Mock and Ad-EGFP groups.In contrast,the mortality of rats in the Ad-ACE2 group was lower than that in the Cilazapril group.4.2 Efficiency of ACE2 gene transferCompared with the Mock and Ad-EGFP groups,the mRNA and protein expression levels and the activity of ACE2 were significantly higher in the Ad-ACE2 group 2 weeks after ACE2 transfection,with a slight increase in the Cilazapril group.And these measurements was significantly lower in the Cilazapril group than in the Ad-ACE2 group.The results also showed that ACE2 mRNA and protein expressions and activity were increased in the Mock and Ad-EGFP groups compared with the control group.4.3 Pathological changesAnalysis of H&E stained sections in the Mock and Ad-EGFP groups of rats were characterized by inflammatory cells invasion,loss of myofibrils and disorganization.However,these pathological changes were alleviated in sections from Ad-ACE2 and Cilazapril groups,and the alleviative degree of the pathological changes was less in the Cilazapril group than in the Ad-ACE2 group.4.4 ACE2 and ACE expressionAs showed by Western blot analysis,ACE2 protein expression in the Ad-ACE2 group was significantly increased compared with the control,Mock,Ad-EGFP and Cilazapril groups 4 weeks after gene transfection.In addition,ACE2 expression in the Cilazapril group was slightly increased compared to the control group but not compared to the Mock and Ad-EGFP groups.In contrast,ACE protein expression was significantly higher in the Mock and Ad-EGFP groups than in the control,Ad-ACE2 and Cilazapril groups,with no statistically difference between the Mock and Ad-EGFP groups or between the Ad-ACE2 and Cilazapril groups.4.5 Angll and Ang(1-7)expressionAs revealed by ELISA,myocardial and plasma Ang(1-7)levels showed significantly increase in the Ad-ACE2 group compared with the Mock and Ad-EGFP groups.In contrast,the measurements were only slightly higher in the Cilazapril group than in the Mock and Ad-EGFP groups,and were lower in the Cilazapril group than in the Ad-ACE2 group.In contrast,myocardial and plasma Angll protein expression levels by ELISA were lower in the Ad-ACE2,Cilazapril and control groups than in the Mock and Ad-EGFP groups,and these were higher in the Cilazapril group than in the Ad-ACE2 group.4.6 TUNEL assay and c-caspase3 and Bcl-2 protein expressionTUNEL assay was performed and the results showed that radio of TUNEL positive cells were significantly decreased in the Ad-ACE2 and Cilazapril groups compared with the Mock and Ad-EGFP groups,with no significant difference between the Mock and Ad-EGFP groups or between the Ad-ACE2 and Cilazapril groups.The c-caspase3/caspase3 radio in myocardium was also significantly decreased in the Ad-ACE2 and Cilazapril groups compared with the Mock and Ad-EGFP groups,with no significant difference between the Mock and Ad-EGFP groups or between the Ad-ACE2 and Cilazapril groups.In contrast,Bcl-2 protein expression was significantly increased in the Ad-ACE2 and Cilazapril groups compared with the Mock and Ad-EGFP groups,and was significantly decreased in the Cilazapril group compared with the Ad-ACE2 group.4.7 AMPKprotein expressionThe pAMPK(Thr172)/AMPK radio in myocardium was significantly higher in the Ad-ACE2 and Cilazapril groups than in the Mock and Ad-EGFP groups.However,this radio was significantly lower in the Cilazapril group than in the Ad-ACE2 group.4.8 Expression levels of inflammatory cytokinesThe protein expression levels of VCAM-1 and TNF-a by immunohistochemical analysis in Ad-ACE2 and Cilazapril groups were significantly lower than those in the Mock and Ad-EGFP groups.However,the VCAM-1 and TNF-a protein expression in the Ad-ACE2 group was lower than in the Cilazapril group.Western blot analysis further confirmed immunohistochemical results,a similar distribution in all 5 groups.Similarly,the protein expression level of ICAM-1 by western blot analysis in Ad-ACE2 and Cilazapril groups was significantly lower than in the Mock and Ad-EGFP groups,with no statistical difference between the Mock and Ad-EGFP groups or between the Ad-ACE2 and Cilazapril groups4.9 NOX2,P47 and iNOS protein expression and SOD activityThe protein expression levels of NOX2,P47 by western blot analysis were substantially lower in the Ad-ACE2 and Cilazapril groups than in the Mock and Ad-EGFP groups.Furthermore,the P47 protein expression in the Cilazapril group was higher than in the Ad-ACE2 group,while the protein expression level of NOX2 had no statistically difference between the Ad-ACE2 and Cilazapril groups.Additionally,SOD activity was significantly increased in the Ad-ACE2 and Cilazapril groups compared with the Mock and Ad-EGFP groups.However,SOD activity in the Ad-ACE2 group was higher than in the Cilazapril group.iNOS protein expression by western blot analysis in the Mock and Ad-EGFP groups was significantly increased compared to Ad-ACE2 and Cilazapril groups,with no statistical difference between the Mock and Ad-EGFP groups or between the Ad-ACE2 group and Cilazapril group.4.10 ERK protein expressionCompared with Mock and Ad-EGFP groups,phosphorylated ERK protein expression by western blot analysis was significantly reduced in the Ad-ACE2 and Cilazapril groups,with no significant difference between the Mock and Ad-EGFP groups or between the Ad-ACE2 and Cilazapril groups.4.11 Expression levels of PI3K and AKTThe pPI3K/PI3K and pAKT/AKT radios in myocardium were significantly lower in the Mock and Ad-EGFP groups than in the control,Ad-ACE2 and Cilazapril groups.In addition,these results in the Ad-ACE2 group were significantly increased compared with the Cilazapril group.There was no statistical difference between the Mock and Ad-EGFP groups.4.12 HR.BP and Echocardiographic measurementsHowever,ACE2 and cilazapril had no significant effect on blood pressure and heart rate in adriamycin-induced cardiomyopathy rats.LV...