The Effect And Its Mechanism Of MiR-212 On The HPA Axis Activity During Stress

BackgroundStress(so called stress reaction)is a systematic adaptive response to intrinsic or extrinsic environmental challenges as well as social and psychological factors,which is characterized by the activation of hypothalamic–pituitary–adrenal axis(HPA)and the consequent release of corticotropin releasing hormonecortical(CRH)and vasopressin(VP)by the neurons in the paraventricular nucleus of hypothalamus.Increase of CRH promotes the secretion of adrenocorticotrophic hormone(ACTH)by the pituitary cortical cells which in turn stimulate the production of glucocorticoid(GC)by the adrenal cortex.GC plays a critical role in the guarantee the of energy supply of the tissue,maintaining the cardiovascular response to catecholamines,as well as anti inflammatory and compensatory defense reaction.Under physiological condition,there was a feedback balance between the secretion of GC and the HPA activity,but it is susceptible to impairment under stress condition.Since the maintenance of HPA activity in physical range is pivotal for the normal function of metabolism,circulation,inflammation/immunology and neuro-psychology,the mechanism of HPA regulation has long been a central topic of stress study especially in military medicine.Recently,it is found that alternative pathways other than the negative feed back effect of GC also exist in the control of HPA activity,amongst which CRH has been attracting more and more interest and is believed to play a crucial role.Thus the expression control of CRH itself might be of critical significance for the regulation of HPA activity.It is known that many neurotransmitters and cytokine can affect CRH expression via various intracellular signal pathways.However,the underlying more detail mechanism is still to be elucidated.Recently year has evidenced a powerful role of microRNA in gene expression by its posttranscriptional targeting of mRNA,either inhibiting its translation or inducing its degeneration.Thus,microRNA is highly involved in various biological processes.Previous studies suggested that microRNA might play a role in stress reaction through regulation of PHA activity.But whether this effect is microRNA dependent remains unknown.ObjectiveTaken together,we believe it is well worth to investigated if microRNA can affect the PHA activity thorough regulating CRH expression in the hypothalamus,and this is the primary goal of the current study.Methods1.Animals.Male C57BL/6(8 weeks old)mice were purchased from Slac Laboratory Animal(Shanghai,China)and maintained at 22±2?,12 h light/12 h dark cycle(07:00 light on/19:00 light off)with food and water freely available.All animal experiments were conducted in accordance with the National Institute of Health's “Guide for the Care and Use of Laboratory Animals”,and with the approval of the Second Military Medical University Institutional Animal Care and Use Committees.2.Repeated stress process.After acclimated for 1 week,40 mice weighing approximately 22±2g were divided randomly into five groups(n=8)for repeated heat stress,which include Day 0(without exposure),Day 1(exposed for one time),Day 3(exposed for three times),Day 7(exposed for seven times)and Day 14(exposed for fourteen times)according to the time of stress exposure.Another 40 mice in the same batch were also divided randomly five groups for repeated restrain stress.Details of the stress procedures are as follows:(1)Heat stimulus: mice were placed in artificial climate cabin with temperature 40? and relative humidity 60% for 1h;(2)Immobilization: mice were placed in 50 ml centrifuge tube(28mm diameter×105mm long)with punching hole for 1h.All experiments were conducted between 09:00 am and 10:00 am every day.The mice were decapitated at the end of exposure,then blood and hypothalamus were collected immediately.The blood was centrifuged at 3000g/20 min to obtain serum for ACTH and CORT detection and hypothalamus were used to extract RNA and protein for real-time PCR and western blot.3.microRNA microarray and data analysis.Hypothalamus were obtained from another 15 mice in Day 0,Day 1 and Day 7(5 mice in each group).Total 15 RNA samples abstracted by using Trizol reagent(Invitrogen,Shanghai,China)were processed in Affymetrix Gene Chip miRNA3.0(Invitrogen,Shanghai,China)to profile patterns of microRNA expression.The random-variance model(RVM,which commonly used for comparison of more than two groups)F-test was applied to filter the differentially expressed microRNAs for the three groups because the RVM F-test can raise degrees of freedom effectively in the cases of small samples.After the significant analysis and FDR analysis,we selected the differentially expressed microRNAs according to the p-value threshold.4.Injection of miR-212 agomir and antagomir in mice hypothalamus.microRNAagomir andantagomir cloud be injected to local site for functional research.45 mice weighted 26-28 g were divided into 5 group: Day 0,1,3,7,14,and each group has three subgroup injected with 2?l Negative Control,miR-212 agomir and miR-212 antagomir(Genepharma,Shanghai,China)at concentration of 1OD/?l(approximately 2.5nmol/?l)in PVN respectively.The injection was carried out by mouse brain stereotaxic apparatus and the injection coordinates was 0.82 mm caudal and 0.1 mm lateral from Bregma and 4.75 mm ventral from the surface of the skull at Bregma according to The Mouse Brain in Sterotaxic Coordinates,second edition by Paxinos and Franklin.5.Determination of serum hormone concentrations.Serum ACTH and CORT were measured by radioimmunoassay kits(North Institute of Biological Technology Co.Beijing,China)following the manual protocol.6.Mice hypothalamic primary cell and HT22 Culture.Primary cells of mice hypothalamus with identification report were purchased from Zhongqiaoxinzhou Biotech INC.(Shanghai,China)and cultured in primary neurons culture system(i Cell,Shanghai,China)with pre-coated poly-L-lysine.HT22 cells(kindly provided by Dr.David Schubert),a mice hippocampus neuron cell line which was taken as another proof of miR-212 regulating CRH because it also has CRH expression,were grown in DMEM(Hyclone,USA)supplemented with 10% FBS(Gibco,USA)and 1% antibiotic solution(Gibco,USA)and incubated in a humidified 5% CO2 atmosphere at 37°C.7.Transfection.For hypothalamic primary cell transfection,miR-212 agomir and antagomir(Genepharma,Shanghai,China)were used at concentration of 50 n M and 100 n M respectively.And miR-212 mimics and inhibitors(Genepharma,Shanghai,China)were transfected to HT-22 cells at the concentration of 50 n M and 100 n M respectively.Plasmids for CREB(Genepharma,Shanghai,China)were transfected at the concentration of 3ug/ml.All transfection processes were mediated by micropoly-transfecter TM cell reagent(Micropoly,Nan Tong,China).8.Dual-Luciferase Reporter Assay.HT-22 cells were grown on 96-well plates to 50% confluence approximately and plasmids of GP-miRGLO(Genepharma,Shanghai,China)containing either the wild-type or mutated CRH 3'UTR were co-transfected with miR-212 mimics or negative control.48 hours after transfection,the cells were lysed for luciferase activity with a Dual-Luciferase? ReporterAssay System(Promega,Mannheim,Germany).Firefly luciferase activity was normalized to Renilla luciferase activity for each cell culture.9.Total RNA and protein extracted from mice hypothalamus and cells.Because of the small size of mice hypothalamus,it is hard to part it for RNA and protein extraction.So we use All-In-One DNA/RNA/Protein Mini-preps Kit(Sangon Biotech,Shanghai,China)to extract RNA and protein simultaneously.In general,after tissue homogenization and lysis,the liquid was centrifuged in RNA purification column to obtain RNA and the flow-through was added with PP solution to precipitate protein.In cells,RNA was extracted by Trizol reagent(Invitrogen,Shanghai,China)and protein was extracted by whole protein extraction kit(Keygene,Nanjing,China).10.Real-Time Quantitative PCR Analysis.1ug RNA of each sample was reversely transcribed to c DNA by Reverse-Transcription Reagent Kit(Takara Bio Inc.,Japan).Real-time quantitative PCR amplification was performed with the SYBR Green Kit(Toyobo Bio Inc.,Japan)using the Step One Plus TM(Applied Biosystems,USA).mRNA expression were normalized to 18 s while miRNA were normalized to U6.The primers used were as follows: 18s-forward:GTAACCCGTTGAACCCCATT,18s-reverse:CCATCCAATCGGTAGTAGCG;CRH-forward:TCTCACCTTCCACCTTCTGC,CRH-reverse: AAGCGCAACATTTCATTTCC;CREB-forward:TGCCAACTCCAATTTACCAA,CREB-reverse: ACCCCATCGGTACCATTGTT.Primer set for U6 and miR-212 were purchased from Genepharma(Shanghai,China).11.Western Blot.30 ug denatured protein was electrophoresis in SDS-page gel and transferred to PVDF membrane(Life Science,PALL,USA)using Bio-Rad system.The antibodies used were: anti-?-actin(Sangon Biotech,Shanghai,China),anti-CRH antibody,anti-CREB1 antibody and anti-CREB1(Phospho-Ser142)were purchased from Abcam(USA).Gray scales of target protein measured by Gene Snap from Syn Gene software package were normalized to ?-actin.12.Statistics.Data were represented as mean ± SEM.Statistical difference between two groups was assessed by the independent T-test.One-way ANOVA,followed by Bonferroni test as a post-test,was performed to analyze the difference between the three or more groups.Differences were considered significant at the 95% confidence level(P<0.05).Results1.Hypothalamic miR-212 expression was escalated in mice exposed to repeated stress and CRH expression was increased at first then partly decreased1.1 mircroRNA expression pattern in hypothalamus mice exposed to repeated stress and bioinformatics analysisTo observe the dynamic change of microRNAs expression in hypothalamus of mice exposed to repeated stress,we used Affymetrix Gene Chip miRNA3.0 to investigate the expression pattern of microRNAs in hypothalamus exposed to heat stress for one time and seven repeated times.Among all the microRNAs detected,there were 41 microRNAs have significant change.By analysis of sequence matching,we found that only miR-212-5p could bind with CRH 3'UTR and the expression of it was escalated in Day 1 and Day 7 compared with Day 0.1.2 Effects of repeated heat or restraint stress on hypothalamic miR-212 expression,CRH expression and serum concentration of ACTH/CORTWe conducted two kinds ofrepeated stress process on mice and increase two groups: Day 3 and Day 14 to elucidate changes of miR-212 expression and HPA axis activity more concretely.miR-212 expression was escalated during stress process while HPA axis was activated once exposed to stimulus and climaxed at Day 3 approximately then subsequently showed a significant decrease at Day 7 and Day 14.A meaningful phenomenon was that mice subjected to restraint stress showed a higher level of miR-212 increase with a lower level of CRH expression than heat stress.Though HPA axis activity was restored to a certain degree,it was obvious that the decreased activity of HPA axis at Day 7 and Day 14 was still higher than Day 0.2.Mechanisms of CRH expression regulation by miR-2122.1 miR-212 regulated CRH expression in primary cells of mice hypothalamus and hippocampus cell HT-22To explore whether there was a role of miR-212 in regulating CRH expression,we firstly observe changes of CRH expression in primary hypothalamic cells after over-expression or inhibit of miR-212.Over-expression of miR-212 by miR-212 agomir transfection lead to decreased mRNA expression ofCRH while inhibit of miR-212 by miR-212 antagomir transfection increased mRNAexpression of CRH.We proved that miR-212 mimcs or inhibitors transfection could decrease or increase mRNA expression and protein expression of CRH respectivelyin HT-22,a kind of hippocampus cell which also expressing CRH.2.2 Dual-Luciferase Reporter Assay indicated that miR-212 could bind with CRH 3'UTRWe constructed GP-miRGLO plasmids contain wild-type or mutated binding site of CRH 3' UTR with miR-212.The result of Dual-Luciferase Reporter Assay shows that co-transfected wild-type plasmids and miR-212 mimics could significantly reduce the relative luciferase activity but when the binding site was mutated,the role of miR-212 mimics was disappeared.2.3 A negative feedforward was mediated by miR-212 to limit CREB-mediated CRH expressionCREB(c AMP response element binding protein)had been reported as a transcript factor of miR-212 and CRH.We observed that CREB showed a same trend in mRNA expression with miR-212 in heat/restraint stress process.The protein expression and phosphorylation level of CREB in heat stress process and restraint stress process also showed a gradual increase.We co-transfected CREB plasmids and miR-212 mimics or inhibitors to observe role of miR-212 in CREB-mediating CRH expression.Over-expression of CREB by plasmids transfection resulted in increased levels of miR-212 and CRH.Co-transfection of CREB plasmids and miR-212 mimics made the increase of CRH expression fallen while miR-212 inhibitors amplified the role of CREB over-expression on CRH expression.So we thought that miR-212 was probably taken as a kind of negative feedforward to limit over expression of CRH when CREB was activated during stress.3.miR-212 regulated CRH expression and further affected HPA axis activity in vivoConsidering that miR-212 played a role in regulating CRH expressionin vitro,we want to know whether miR-212 regulated CRH expression and HPA axis activity in vivo.We conducted a 14 days heat stress process on mice with injection of negative control,miR-212 agomir or miR-212 antagomir in hypothalamus.Consisted with results of experiments on cells,mice injected with miR-212 agomir showed a significant increase of miR-212 in hypothalamus and decrease of CRH mRNA and proteinexpression and the injection of miR-212 antagomir lead to opposed appearance.On the same time,CREB and p-CREB levels increased gradually without the influence of the injection during long-term repeated stress.A more meaningful result was that injection of miR-212 agomirlead to decreased serum content of ACTH and CORT compared with injection of negative control.And injection of miR-212 antagomir augmented the stress response with increased serum content of ACTH and CORT.These results mean that miR-212 could modulating HPA axis activity by regulating CRH expression in vivo.Conclusions1.Hypothalamic miR-212 expression was escalated in mice exposed to repeated stress and CRH expression was increased at first then partly decreased.2.miR-212 limited CREB-mediated CRH expression in a negative feedforward way in vitro.3.miR-212 regulated CRH expression and further affected HPA axis activity in vivo.In summary,we deemed that upon stress exposure,CREB was activated as a switch activating HPA axis by upregulation of CRH expression.But a fuse,which miR-212 seems to be,was upregulated by CREB at the same time to prevent over activation of HPA axis.