Font Size: a A A

Hepatic Stellate Cell Specificly-targeted Penetrating Peptide: Screening And Its Effects Of Apoptosis Induction Through Delivery Of KLA Peptide

Posted on:2018-07-13Degree:DoctorType:Dissertation
Country:ChinaCandidate:Z R GuoFull Text:PDF
GTID:1314330569986182Subject:Internal medicine
Abstract/Summary:
Liver fibrosis,the common pathological process of various chronic liver diseases caused by multiple pathogenic factors,is characterized by excessive deposition of extracellular matrix(ECM;predominantly collagen),which may progress to end-stage liver diseases such as liver cirrhosis and liver cancer.Approximately 1.4 million people die each year from chronic liver diseases globally,which has become a serious health issue worldwide.To date,numerous long-term studies have been conducted on various aspects of the mechanism of carcinogenesis in terms of the treatment of liver fibrosis,and a number of anti-fibrosis drugs have been developed.However,due to poor specificity and unwanted side effects,ideal drugs against liver fibrosis are still lacking currently in the clinical setting.Therefore,it is urgent to develop effective anti-fibrosis drugs with minimal side effects.Targeted drugs have become a novel approach for the treatment of various diseases in the past decades because they exclusively and specifically affect key cells that cause diseases and due to the characteristics of fewer side effects,strong specificity and high efficacy.Activation of hepatic stellate cells(HSCs)are recognized as a major and central player in liver fibrogenesis.Under physiological conditions,HSCs exist in a quiescent state.In response to inflammation or mechanical stimulation,HSCs are activated by various fibrogenic factors.Activated HSCs secrete fibrogenetic factors,which promote collagen production and ECM accumulation.Additionally,activated HSCs can inhibit the activation of matrix metalloproteinases and reduce matrix degradation.Overproduction of collagen and decreased degradation cause its excessive deposition of ECM,giving rise to the occurrence of liver fibrosis.Therefore,it is a novel strategyto develop effective targeted drugs specific to HSCs by inhibiting activation or inducing apoptosis of HSCs.The mechanism of targeted drug lies in the fact that the drug or factor is delivered into the cells by means of a carrier that can specifically enter specific pathogenic cells,thereby producing the therapeutic effects.Its exclusive action on pathogenic cells yields definite therapeutic benefit and minimal side effects.Various specific vectors are available,among which cell-penetrating peptides(CPPs)have drawn much attention due to high transduction efficiency and low toxicity.CPPs,also known as protein transduction domains(PTD),are cationic short peptides with 5–30 amino acids.CPPs could transport a variety of agents different in size and properties,such as polypeptides,proteins,nucleic acids,nanoparticles,viral particles and drugs,across the cellular membrane,resulting in internalization of the intact cargo.This provides a powerful vehicle for the entry of biomacromolecules and drugs into the cell.CPPs include both tissue-specific and non-tissue-specific peptides.Tissue cell-specific penetrating peptides are supposed to carry the target gene to a specific target tissue,and maintain a high concentration at the target site,thus producing a satisfactory therapeutic effect and minimizing adverse effects.Currently,specific CPPs are obtained mainly by phage display,plasmid display and microbial surface rendering.The principle of phage display is a gene encoding a protein of interest is inserted into appropriate position of the phage coat protein structure gene.The exogenous polypeptide or protein is fused to the coat protein,and the fusion protein is shown on the phage surface by the reassembly of the progeny phage,resulting in a connection of phenotype with genotype.The displayed polypeptide or protein facilitates recognition and binding of the target molecule.Peptide library and solid phase on the target protein molecules after a certain period of time after the incubation of unbound free phage,and then competing to accept the receptor or acid elution with the target molecules to adsorb the phage,eluting phage infected host cells.Hence,the phage that specifically binds to the targetmolecule is highly enriched.These displaying phages can then be further used to enrich the target phage with desired binding properties.This study aims to screen and validate a HSC-specific CPPs using phage display technology,to synthesize a chimeric peptide composed of CPPs and KLA peptides,which was then delivered into the interior of HSCs.Apoptosis-inducing effect of HSCs may provide a new strategy for the treatment of liver fibrosis.This thesis is divided into three parts as follows:Part Ⅰ Screening and validation of Hepatic Stellate Cell-targeted Cell-Penetrating Peptides(HTP)Objective: To screen HSC-T6 cell-specific penetrating peptides using phage display technique in vitro and to validate their penetration and specificity.Methods: We screened the phage peptide with specific penetrating ability in HSC-T6 cells of rats from phage-displayed random 12-peptide library and cyclic heptapeptide library.HTP was labeled with FITC(FITC-HTP),and rat HSC-T6 cells were incubated with different concentrations of FITC-HTP to detect the fluorescence in the cells.FITC-labeled TAT(FITC-TAT,a non-tissue cell-specific penetrating peptide that could efficiently penetrate various cells)was used as a positive control,whereas FITC-labeled KLA(FITC-KLA,a polypeptide that could not penetrate cell membrane)served as a negative control,to observe its penetrability in a variety of species and organ-derived cells.Results:1 Screening of HTP in ratsAfter three rounds of screening,the results showed that with an increase in the number of rounds,the number of blue stains on the plate was enhanced incrementally.This indicated that due to the increased number of rounds,the number of phages capable of penetrating HSC-T6 rose incrementally,as with phage recovery rate.The target phage was initially screened.A comparative analysis of sequencing results revealed that two sequences(GPTAKYI and VPSKPGL)were capable of internalizing into heptapeptide of HSC-T6,wherein GPTAKYI sequences increased with increased number of rounds,suggesting a more pronounced enrichment of phages.Owing to its highest frequency of enrichment during these screens,GPTAKYI,with a nucleic acid sequence of GGTCCGACTGCGAAGTATATT,was selected as dominant peptide of HSC-T6 cells for further characterization and termed as an HTP.2 HTP could penetrate and enter HSCs of ratsRat HSC-T6 were incubated with different concentrations of FITC-HTP to detect the fluorescence in the cells.The results showed that fluorescence was detected in HSC-T6 cells treated with 50 μ M FITC-HTP,and the intracellular fluorescence gradually increased with an increase in incubation concentration,indicating that HTP could penetrate and enter HSC-T6 cells.3 HTP had cell specificityAfter FITC-TAT incubation,fluorescence was observed in seven tested cells,including HSC-T6(rat HSCs),LX-2(human HSCs),RH35(rat hepatoma cells),ECV304(human umbilical vein endothelial cells),HEK-293(human embryonic kidney cells),HepG2(human hepatoma cells)and QSG-7701(human normal hepatocytes).After FITC-KLA incubation,all cells showed very faint green fluorescent signals.Nonetheless,after FITC-HTP incubation,only strong green fluorescent signals were observed in HSC-T6 cells,but relatively weak signals in the other 6 cells.This indicated that HTP was cell-specific,which could internalize specifically into rat HSC-T6 cells.Conclusion: HTP that specifically enters the HSC-T6 of rats was successfully screened by phage display technology,demonstrating excellent penetrability and specificity.Part Ⅱ Synthesis and functional characterization of HTP and KLA peptidesObjective: To synthesize a chimeric peptide composed of HTP and KLA peptide,and to identify apoptosis-inducing function of KLA after it was delivered into HSC-T6 using HTP as carrier.Methods: A chimeric peptide composed of HTP and KLA peptide wassynthesized and named as HTPK25.KLA was delivered to HSC-T6 with HTP as carrier.HTP and KLA peptide were used as positive and negative controls,respectively.HTP was labeled with FITC,and observed under a laser scanning confocal microscope,to evaluate whether HTPK25 was able to internalize HSC-T6 cells.After TUNEL staining,cleaved-caspase-3,an active form of apoptotic marker protein caspase-3,was detected to observe the apoptosis of HSC-T6 cells treated with HTPK25.Results:1 Synthesis of HTPK25 composed of HTP and KLA peptides and Penetration TestThe results revealed that notable green fluorescence was observed in HSC-T6 cells treated with FITC-HTP and FITC-HTPK25,and the fluorescence signals intensified with increasing concentrations of both the HTP and HTPK25.No green fluorescence was noted in HSC-T6 cells with a low dose of FITC-KLA.As the dose increased,a very low or undetectable green fluorescent signal was observed.It was indicated that HTP not only entered HSC-T6 cells by itself,but also delivered KLA peptide into HSC-T6 cells,and the fluorescence signals intensified with an increased dose.However,KLA peptide itself could not enter the interior of HSC-T6 cells.2 Validation of apoptosis induced by HTPK25 in HSC-T6 cellsThe number of apoptotic cells in HSC-T6 incubated with HTPK25 were significantly larger,as compared with those incubated with peptide HTP alone,indicating that HTPK25 could induce HSC-T6 apoptosis.And the cleaved-caspase-3 levels in HTPK25-treated HSC-T6 were remarkably higher than those of the cells incubated with peptide HTP alone,suggesting that HTP could deliver KLA peptide into HSC-T6 to induce apoptosis.Conclusion: HTPK2,a chimeric peptide composed of HTP and KLA peptide was successfully constructed in HSCs of rats.HTP is able to deliver functional peptide KLA into rat HSC-T6 cells and induce its apoptosis.Part Ⅲ HTP coupled with pre-apoptotic peptides to induce HSC apoptosis and inhibit their activationObjective: To pinpoint the role of HTPK25,a chimeric peptide consisting of HTP and pro-apoptotic peptide in HSC-T6 cells.Methods: TUNEL apoptosis assay kit and flow cytometry were used to detect the apoptosis of HSC-T6 treated with different doses of HTPK25 for 24 h and with the same dose of HTPK25.Cell viability was assayed by CCK-8assay and stained with mitochondrial dye MitoTracker? Red CMXRos to reveal mitochondrial morphology,which was then observed under confocal microscopy.Real-time PCR and Western blotting were employed to detect the mRNA and protein levels of HSC-activatedα-SMA and collagen I.Results:1 HTPK25 induced apoptosis of HSC-T6 in a time-and dose-dependent mannerFlow cytometry results showed that at 0,6,12,24 h after HTPK25 was transfected into HSC-T6 cells,the number of HSCs with Annexin V/FITC positive staining was gradually increased.Similarly,TUNEL assay indicated that TUNEL-positive HSCs also increased in a time-dependent manner as HTPK25 was transfected into HSC-T6 cells.The findings suggested that HTPK25 induced apoptosis of HSCs in rats in a time-dependent fashion.In addition,HSC-T6 was incubated with different doses(10μM,20μM,30μM,40μM)of HTPK25 for 24 h.The results by flow cytometry demonstrated that the number of Annexin V/FITC positive HSCs gradually increased with the increase of HTPK25 in a dose-dependent manner.Similarly,TUNEL assay demonstrated that TUNEL-positive HSCs increased gradually with an increased doses of HTPK25 in a dose-dependent fashion.The above results show that HTPK25 can induce rat hepatic stellate cell apoptosis in a dose-and time-dependent manner.2 HTPK25 inhibited cell viability of HSC-T6HTPK25 could decrease the viability of HSC-T6 cells.As the dose of HTPK25 increased,cell viability of HSC-T6 was reduced significantly in a dose-dependent manner.However,HTP did not induce a reduction in viability of HSC-T6 cells,and cell viability did not change with dose.The medianlethal dose of HTPK25 to HSC-T6 cells was 35μM.3 HTPK25 caused HSC-T6 mitochondrial morphological changesMitochondria were labeled as red fluorescence.After HTP treatment,the structure of mitochondria remained intact,whereas the red fluorescence had spotty apperance after HTPK25 incubation.Compared with HTP group,the nuclei of HTPK25-stained blue dye were condensed and decreased.This suggested that HTPK25 could cause mitochondrial destruction and nucleus condensation in HSC-T6 cells.HTPK25 might induce apoptosis by disrupting the mitochondrial structure.4 HTPK25 inhibited HSC-T6 activationReal-time PCR results showed that the expression of collagen I andα-SMA mRNA in HTPK25-treated HSC-T6 was significantly reduced,as compared with HTP-incubated cells.Consistent with Western blotting results,HTPK25 inhibited the protein expression of collagen I andα-SMA in HSC-T6,indicating HTPK25 inhibited HSC-T6 activation and reduced collagen secretion,thus playing a role of anti-liver fibrosis.Conclusion: HTP25,a chimeric peptide composed of HTP and KLA peptides can induce HSC-T6 apoptosis in rat HSCs in a time-and dose-dependent manner,inhibit its viability and contribute to destruction of mitochondria structure,thereby inhibiting its activation,reducing collagen production,and exerting a role of anti-liver fibrosis.
Keywords/Search Tags:Cell-penetrating peptide, KLA peptide, Screening and identification, Apoptosis, Collagen degradation
Related items