| Backgroud and Objective Bladder cancer(BC)holds a significant burden to society,representing the ninth most common malignant disease and the thirteenth most common cause of cancer death world-wide.According to the World Health Organization(WHO),the number of BC cases and deaths are expected to almost double in the near future.Whereas systemic treatment has been limited to cisplatin-based chemotherapy with little progress over the past several decades,extensive analysis of molecular alterations in bladder cancer has now led to novel treatment approaches.Furthermore,a more accurate stage-specific classification could be helpful in better tailoring treatment based on the risk of recurrence and progression,and possibly on biomarkers.Intensive studies are being performed to understand the complex and dynamic molecular profiles of BC.These efforts involve looking BC mechanism at the multiple levels of the genome,epigenome,transcriptome,proteome,lipidome,metabolome etc.Among which more improvement has been made in understanding genomic alteration.WTAP is widely expressed in various tissues and plays an important role in the normal cellular and physiological processes,such as cell cycle regulation and regulating the balance between quiescence and proliferation.It is reported that overexpression of WTAP promotes smooth muscle cell proliferation and inhibits its apoptosis.WTAP has also been shown to have a close relationship with malignant tumors.For instance,WTAP was shown to be overexpressed in cholangiocarcinoma,in particular in patients with lymph node metastasis or vascular invasion.In addition,in vitro assays showed that WTAP has an important role in the migration and invasion of cholangiocarcinoma cells,which was also demonstrated for glioblastoma.Besides solid tumors,an oncogenic role for WTAP was also observed in acute myeloid leukemia(AML).However,to the best of our knowledge,no previous studies have investigated the relationship between WTAP and BC.Therefore,the present study aimed to evaluate the expression of WTAP in BC tissue and cell lines,and its association with the clinicopathological factors and prognosis of patients with BC.Moreover,we investigated the influence of WTAP overexpression on BC proliferation and apoptosisMaterials and methods1.Patients and tissue samples:A total of 62 fresh specimens of bladder transitional cell cancer tissues were collected as the bladder cancer group(Male:Femal,48:14,average age:57± 19),while control goup included 20 normal bladder mucosa specimens(Male:Femal,14:6;average age:52±13).2.H&E staining:Bladder tissues were embedded into the paraffin waxes and were made into paraffin blocks which were cut into 5 μm-thick sections.Then,H&E staining was conducted using the routine histopathological method.All stained specimens were observed under light microscope(200x).3.Immunohistochemistry(IHC):IHC was adopted to test the expressions of WTAP in the tissues of two groups and investigate their relations with the clinical pathological features and effects on the prognosis.4.qRT-PCR:Total RNA was extracted from clinical samples or cultured cells by Trizol reagent and used to synthesize cDNA with the Primescript RT Reagent.Real-time RT-PCR was carried out using Power SYBR Green PCR Master Mix,and the primer sequences of WTAP were as follows:5’-3’CAACCTCTTTAGCCAAACAAGAA and 3’-5’ ATTCCTGAGTGCAACAGC.5.Western blot:Total protein extracted from clinical samples.Following antibodies were used:WTAP monoclonal antibodies,GAPDH antibody and HRP-conjugated secondary antibody.6.Kaplan-Meier survival curves and log-rank survival analysis were conducted to show the effects of both the negative and positive WTAP expressions on the prognosis of patients.7.Cell culture and transfection:Normal Human uroepithelium cell line(SV-HUC-1)and bladder cancer(T24 and 5637)cell lines were routinely cultured in basic media plus 10%fetal bovine serum.Incubate at 37℃ in 5%C02.5×103 cells/well were seeded in a 96-well plate for 24 h,at 50%confluence,followed by the transfection with WTAP overexpression Lentivirus plasmid..8.Cell proliferation and cell apoptosis assays:Transfection efficiency of WTAP-overexpression plasmid was measured by qRT-PCR(48h after transfection).The relative viability of BC cell was determined by MTT assay at 0,24,48,72h after transfection.Apoptosis caused by WTAP overexpression was determined at 72h after transfection,using the Caspase 3 ELISA assay kit.The procedures for cell proliferation and cell apoptosis assays were performed according to the manufacturer’s instructions.9.Statistical analysis:Statistical analysis was performed by using SPSS(Version 24.0 for mac).The results are presented as the mean ± SD from three different independent experiments.All p values were two-sided.A p value<0.05 was considered to be statistically significant.Results1.H&E staining detection showed that the structures of cells in the bladder cancer group were destroyed with shrunk cell nucleuses,the cells are heteromorphic,with more mitotic figures,heterogeneous nuclei and deep staining while the tissues in the control group were intact.2.The WTAP IHC staining indicated that brownish-yellow and tan cell nucleuses were generated in the tissue sections and the expression level of WTAP in BC group was more than that in control group.3.According to RT-PCR and western blotting detection results,there were a small number of WTAP mRNAs and proteins expressed in the control group,while they were highly expressed in the bladder cancer group.4.Through Kaplan-Meier survival curves and log-rank survival analysis,it was indicated that there were obvious differences in the postoperative recurrence risk between the patients with a positive WTAP protein expression and those with a negative WTAP protein expression(P<0.05).5.WTAP mRNA expression level was significantly upregulated in BC cell lines(T24 and 5637),compared with normal human uroepithelium cell line(SV-HUC-1).6.Cell proliferation and apoptosis changes caused by WTAP-overexpressing.Satisfactory transfection efficiency was obtained,and cell proliferation increment was observed in T24 and 5637 cells by transfection of Lentivirus containing WTAP cDNA.As revealed by ELISA assay,decreased cell apoptosis was presented in both WTAP-overexpressing BC cell lines.Conclusion Overall,our results showed that WTAP was upregulated in BC and could serve as a novel prognostic indicator for BC patients.Moreover,WTAP significantly promoted BC proliferation and inhibited apoptosis in vitro.This shows that WTAP may play an important role in the occurrence and development of BC and could be taken as the potential target for the bladder cancer treatment,providing a new basis for the clinical diagnoses.Because the number of patients’ tissues examined in this study is not enough for generalization,more thorough study is needed in the future. |
