| Background:The prevalence rate of chronic kidney disease(CKD)with high morbidity and mortality is as high as 10.8% in China,while the awareness rate is only 12.5%.The major clinical manifestations of CKD are decreased glomerular filtration rate and increased urine protein.CKD frequently damages multiple systems,including intestinal,cardiovascular and endocrine systems,among which cardiovascular disease(CVD)is the most common complication and leading cause of death(over 50%).Meanwhile,intestinal dysfunction is also a common complication and initial symptom of CKD,whose main clinical manifestations are anorexia,nausea,vomiting,diarrhea,constipation,and intestinal mucosal erosion,ulcer,bleeding at advanced stage.In return,intestinal disorders could enhance the production of uremic toxins,which aggrevate kidney injury and its complications,especially for CVD.As much as 30% of CKD patients have coexisting heart failure(HF),while 40-50% of HF patients suffer from chronic renal dysfunction.Therefore,kidney,gut and heart could interact with each other as a whole.Based on the close relationship among the three organs,some investigators refer them as “kidney-gut-heart” axis,whose dysfunction would lead to a vicious circle,contributing to the progression of CKD and its complications.Thus,it would be of great significance to explore the pathogenesis and therapeutic strategies for CKD-associated intestinal and cardiac dysfunction.Of note,traditional risk factors of CVD and intestinal dysfunction also exist in CKD patients,which can hardly explain such high prevalence of the complicated disease.Therefore,we have been focused on the effect of the accumulated kidney-specific risk factor,uremic toxin,on the injury of heart and gut.Up to now,some researchers,including ourselves,have preliminarily identified the involvement of uremic toxin in the progression of CKD,gut barrier injury and cardiovascular events.As reported,advanced oxidation protein products(AOPPs)induces intestinal epithelial cells(IECs)injury through regulating oxidative stress,and an in vitro study found the damaging effect of urea on gut barrier.Besides,water soluble small compounds,including high phosphate(HP),fibroblast growth factor 23(FGF23)and trimethylamine-N-oxide(TMAO),emerge as hallmarks of CKD and CVD complication.Middle molecules,such as high levels of ?2-microglobulin(B2M),could be a biomarker for coronary artery disease.Protein-bound toxins,including indoxyl sulfate(IS)and p-cresyl sulfate(PCS),are involved in the progression of CKD CVD.Nevertheless,the unique role and molecular mechanisms of uremic toxin in the “kidney-gut-heart” axis have not been fully elucidated.In spite of the preliminary research on the damaging effect of uremic toxin on gut injury,the interaction between uremic toxin and intestinal flora and its mechanisms are far from clear.Especially considering the close relationship between intestinal dysfunction and flora,the role of protein-binding toxins that are metabolized by the gut flora and may in turn damage the intestinal tract and are difficult to remove by routine dialysis,in CKD-associated intestinal disorders deserves special attention.In this study,the involvement of uremic toxins,IS and HP,in the dysfunction of “kidney-gut-heart” axis was preliminarily screened and identified by 16 s ribosomal RNA sequencing of gut faeces and gene microarray analysis on cardiac tissues of CKD mice.Here,their role and mechanism are studied in depth.The preliminary study of this research have screened the participation of interferon regulatory factor 1(IRF1)in the progression of CKD and its complications.Reportedly,IRF1 belongs to the classical transcriptional factor IRF family.The DNA binding domain at N-terminal and transcriptional repression domain at C-terminal allow IRF1 to directly bind to the IRF response element in the promoter region of the target genes to repress their transcription.IRF1 participates in many biological processes,including immunity,inflammation and the initiation and progression of tumor.Recent studies suggested that aortic banding-induced cardiac hypertrophy was exacerbated in transgenic mice with cardiac-specific IRF1 overexpression,while alleviated in IRF1 gene knockout mice.It's known that IRF1 is lowly expressed in the tissues of kidney,gut and heart under physiological state,but its expression and function in pathological conditions of CKD-associated intestinal and cardiac dysfunction remain elusive.Objective:This study aims to elucidate the important role and molecular mechanism of uremic toxin and transcription factor IRF1 in CKD-associated intestinal and cardiac dysfunction,and to explore the intervention strategy.Methods:(1)Phenomena observation5/6 nephrectomy CKD model,hematoxylin eosin(HE)staining,transmission electron microscopy(TEM),intestinal permeability(FITC-dextran),q PCR(detecting the expression of tight junction related genes)assays were used to evaluate intestinal barrier injury.1 6s r RNA sequencing,HPLC,transepithelial electrical resistance(TER),FITC-dextran and TEM observation were carried out to screen and identify the damaging effect of uremic toxin IS on intestinal barrier injury.Cardiac hypertrophy and failure were analyzed by high-resolution echocardiography,HE staining,Wheat Germ Agglutinin(WGA),laser scanning confocal microscopy and q PCR(detecting the expression of hypertrophic genes).Screening and identification of the role of HP in cardiac energy metabolism remodeling were analyzed by microarray,TEM,q PCR,Western blot,seahorse mitochondrial oxygen consumption rate(OCR)analysis,reactive oxygen species(ROS)production,mitochondrial membrane potential and ATP level determination.(2)Mechanism explorationThe role and mechanism of mitophagy in gut barrier injury were investigated by q PCR,Western blot,immunofluorescence and flow cytometry in IS-treated IECs and mice.The effect of IRF1 and dynamin-related protein 1(DRP1)was probed by bioinformatic analysis and further experimental validation.The regulation of HP on IRF1 and peroxisome proliferator-activated receptor gamma coactivator 1 alpha(PGC1?)was also explicated in HP-treated cardiomyocytes and cardiac tissues of mice.Gene knockdown by siRNA and overexpression by recombinant plasmids were constructed to detect the role of IRF1 in mitophagy,intestinal barrier injury,energy metabolism remodeling and HF.The transcriptional regulation of IRF1 on DRP1 and PGC1? was illuminated by bioinformatic analysis,reporter plasmids construction,dual-luciferase reporter assay,point mutation and chromatin immunoprecipitation(ChIP).(3)Intervention effect and clinical verificationIS scavenger AST-120 and IRF1 gene knockout mice were used to evaluate the intervention effect on IS-induced gut barrier injury.Serum samples and intestinal tissues of 12 CKD patients and 12 healthy controls were collected for measuring IS level,IRF1-DRP1 signaling pathway,mitophagy and gut barrier injury.PGC1? effector and IRF1 gene knockout mice were used to detect the rescue effect of HP-mediated effects.Klotho mutant mice(kl/kl),characterized by hyperphosphatemia,were used to verify the role of IRF1-PGC1? signaling pathway in myocardial energy metabolism remodeling and HF.Finally,the clinical parameters of 213 CKD patients were collected to analyze the relationship between HP and cardiac hypertrophy and failure.Results:1.Observation of intestinal mucosal barrier destruction in CKD mice.Compared wit h the control mice,FITC-Dextran gavage showed significantly increased intestinal permeability,HE staining and TEM observed intestinal mucosal damage and destruction of tight junction,while qPCR detection indicated decreased expressions of tight junction-realted genes in CKD mice.The feces of control and CKD mice were taken for 16 s ribosomal RNA sequencing,indicating intestinal flora disorders.Heatmap analysis confirmed significantly higher intestinal Escherichia coli and lower Lactobacillus in CKD mice.However,the TER and q PCR assay showed that the indoles derivative IS,rather than indole,contributed to IECs damage.Intraperitoneal injection of 100 mg/kg IS promoted intestinal permeability,destroyed tight junction and induced intestinal mucosal damage.2.IS inhibits the expression of DRP1 and its mediated mitophagy by promoting the direct binding of IRF1 to the promoter region of DRP1 gene,which further leads to IECs injury.2.1 It was found that IS could promote ROS production,inhibit ATP leve ls,and induce mitochondrial membrane potential loss in IS-treated IECs.Transfection of GFP-LC3 and m Cherry-GFP-LC3 adenovirus respectively,and treatement with autophagy inducer and inhibitor showed that IS could inhibit mitophagy.The accumulation of mi tochondrial autophagosomes was also observed by TEM in both TECs and intestinal tissues of IS-injected mice.2.2 In the subsequent mechanism study,it was found that IS did not affect the classical m TOR signaling pathway,but significantly inhibited the expression of mitochondrial fission-related protein DRP1.We constructed the DRP1 overexpression plasmids and found that it can significantly reverse the IS-mediated mitophagy impairment and IECs damage.2.3 Further bioinformatic analysis and qPCR validation revealed that two potential transcription factors(IRF1 and yin-yang 1,YY1)in the DRP1 promoter region were regulated by IS.Then,it was found that knocking down IRF1,instead of YY1,could reverse the regulatory effect of IS on DRP1.Moreover,when IRF1 expression was reduced,the IS-mediated ROS production,mitophagy disorder,TER suppression and repression of tight junction genes were significantly alleviated.2.4 Based on bioinformatics analysis,we constructed a series of recombinant plasmids with truncated promoter region of DRP1 gene.Dual-luciferase reporter assay,point mutation and ChIP assay confirmed that transcription factor IRF1 can negatively regulate the transcription DRP1 via directly binding to its promoter region(-508 ?-497,CACAGTGAAACC).3.Both CKD mice intraperitoneally injected with AST-120 and IRF1 gene knockout mice injected with IS showed relatively mild intestinal tissue damage,with reduced intestinal tissue damage score and intestinal permeability,denser tight junction,in creased expressions of tight junction-related genes,and restored expressions of IRF1 and DRP1.In addition,the previously accumulated mitochondrial autophagosomes were also significantly reduced.Finally,intestinal barrier injury,disruption of IRF1-DRP1 axis and mitophagic impairment in intestinal tissues,and a higher level of serum IS was observed in CKD patients.4.Observation of HP-induced myocardial energy metabolism remodeling,cardiac hypertrophy and HF in CKD mice.4.1 TEM observation showed mitochondrial derangements,swelling and vacuolation with disrupted cristae in cardiomyocytes of CKD mice.Meanwhile,microarray analysis,q PCR and Western blot indicated reduced expression of PGC1?,a key gene that regulates mitochondrial biogenesis and energy metabolism.The significantly downregulated genes were mainly related with mitochondria.Energy metabolism remodeling occurred in the heart of CKD mice,that is,the downregulation of fatty acid oxidation(FAO)and oxidative phosphorylation(OXPHO)related genes,and the compensatory upregulation of glycolytic related genes.4.2 Given to the close relation between CVD and CKD-inherent risk factors,we screened a series of uremic toxins,and found that HP can significantly inhibit PGC1? expression.Reduced oxygen consumption rate(OCR),lower ATP level,downregulation of FAO and OXPHO-related genes,upregulation of glycolysis-related genes,decreased mitochondrial DNA(mt DNA)copy number,increased reactive oxygen species(ROS)production and loss of mitochondrial membrane potential were observed in HP--treated cardiac cells.4.3 Compared with CKD mice,cardiac hypertrophy and HP were more severe,and the expressions of PGC1? and its target genes were more significantly decreased in high phosphate diet(HPD)-fed CKD mice after 12 weeks.Moreover,the changes in mitochondrial morphology,ATP level and FAO and OXPHO related genes were also more significant.Clinical data also suggested that HP was positively correlated with cardiac hypertrophy and HF.5.HP induces IRF1 expression via acetylating histone H3K9 in IRF1 promoter region,and IRF1 inhibits PGC1? transcription through directly binds to its promoter region,leading to mitochondrial energy metabolism disorder and myocardial remodeling.5.1 Both PGC1? overexpression plasmids and nicotinamide(Nam,a key effector of PGC1?)significantly alleviated HP-mediated low expression of PGC1?,increased production of ROS,disordered expression of metabolic genes,decreased ATP level and hypertrophy of cardiomyocytes.Consistent with the in vitro experiments,intraperitoneal injection of Nam(400 mg/kg/ day)significantly rescued cardiac hypertrophy,HF,and energy metabolic remodeling in HPD-fed CKD mice.5.2 Bioinformatic prediction,qPCR and Western blot demonstrated IRF1 as the only upregulated transcriptional factor after HP treatment,according to in vitro and in vivo studies.We have designed two pairs of siRNA against IRF1,and found that both of them can alleviate the HP-mediated downregulation of PGC1?,increase of ROS formation,reduction of ATP level,changes of metabolic gene expression,and myocardial hypertrophy.The expression of PGC1? was downregulated in IRF1 overexpression plasmids-transfected cells,and upregulated after IRF1 knockdown by siRNA.5.3 Next,treatment with transcription inhibitor actinomycin D,protein translation inhibitor cycloheximide,protease inhibitor MG132 or lysosomal inhibitors chloroquine cannot rescue the inhibitory effect of HP on PGC1? expression,suggesting that the HP-induced PGC1? downregulation is not mediated by mRNA stability or protein degradation pathway.Given to bioinformatic analysis,we constructed 6 truncated plasmids in PGC1? gene promoter region.Subsequentual-luciferase reporter gene,point mutation and ChIP experiment confirmed that IRF1 can directly bind to the PGC1? promoter region(-632 ?-612,TCCTTCTTTCTTTTCCCTATT).5.4 To explore how HP enters cardiomyocytes,we screened phosphate transporters and found that HP significantly upregulated the expressions of Pit1 and Pit2,while simultaneously knockdown the expressions of both Pit1 and Pit2 by si RNA could significantly alleviate HP-induced IRF1 upregulation,PGC1? downregulation and cardiac hypertrophy.5.5 Finally,the ChIP assay confirmed more binding of acetylated H3K9 in the IRF1 promoter region,while histone acetyltransferase inhibitors could reduce HP-mediated IRF1 upregulation.6.Multiple animal model validation and effect intervention.Cardiac hypertrophy,HF and hyperphosphatemia were also observed in kl/kl mice and adenine-induced CKD mouse model,accompanied by higher expression of IRF1,lower expression of PGC1?,mitochondrial dysfunction,and energy metabolism remodeling.Knocking down the IRF1 gene in mice significantly alleviated the HP-induced effects of cardiac hypertrophy,heart failure and energy metabolism remodeling.This study not only confirmed th e unique role of IRF1 in HP-induced HF,but also identified IRF1 as a potential therapeutic target for CKD-associated with CVD.Conclusions:In summary,this study confirmed that uremic toxin is a key factor in inducing CKD-associated intestinal and cardiac dysfunction,and the transcription factor IRF1 is an important link.In mechanism,protein-binding toxin IS inhibits the expression of DRP1 and its mediated mitophagy by promoting the direct binding of IRF1 to the promoter region of DRP1 gene,thus inducing intestinal barrier injury.HP upregulates the expression of IRF1 gene by acetylation of histone H3K9,and IRF1 inhibits PGC1? transcription by directly binding to its promoter region,which eventually leads to myocardial energy metabolism remodeling and HF.In this paper,the clinical phenomena of CKD complicated with intestinal and cardiac dysfunction was clarified from the perspective of the intrinsic association of "kidney-gut-heart" axis,the mechanism of action of uremic toxin IS and HP was illuminated,and the important role of transcription factor IRF1 and its target genes DRP1 and PGC1 was clarified.This study is expected to provide a novel theoretical basis for clinical exploration of the pathogenesis and therapeutic strategies of intestinal a nd cardiac dysfunction in CKD patients. |
PDF Full Text Request