| Currently,genetic circuits are widely used in the dynamic control of metabolic networks,high-throughput screening and directed evolution of high-yield strains.Compared with traditional metabolic engineering methods,genetic circuits can dynamically regulate intracellular metabolic flow,balance cell growth and product synthesis,thereby promoting the efficient synthesis of product.In addition,the genetic circuits can convert the metabolite content signal into a report signal or screening pressure,which could improve the screening efficiency of strains.However,some problems limit the application of genetic circuits in the regulation of central metabolic networks,such as the lack of genetic circuits that respond to central metabolites,the introduction of heterologous regulatory systems may increase metabolic burden,difficulty in integrating multiple signals of central metabolism,and most gene circuits are"open loop".Based on these,this study takes the industrial model microorganism Bacillus subtilis as the research object.Subsequently,the central metabolic network of B.subtilis was globally optimized by constructing gene circuits that respond to key central metabolites,developing endogenous metabolic regulation systems,using logic gates to integrate signals,and designing feedback loops that respond to central metabolites.Finally,the efficient synthesis of glucaric acid and vitamin K2 in B.subtilis was achieved.This study provides new tools and methods for the regulation of the central metabolic network of the microbial chassis cell.The main research contents are as follows:(1)Based on the transcription factor Pdh R that responds to pyruvate,a pyruvate-activated genetic circuit was constructed by inserting the Pdh R binding site(Pdh R Box)into the core region of the constitutive strong promoter P43.Subsequently,we analyzed and identified the response threshold and specificity of the genetic circuit,and found that its intracellular pyruvate response threshold was 10-35?mol/g DCW,and it had a high specificity for pyruvate;Next,the binding constants of Pdh R with P43D(1.4?mol/L)and pyruvate(3.97?mol/L)were detected by using isothermal titration technology.Then,by mutating the non-conserved regions of Phd R Box,Pdh R Box1(ATTGGTAAGACCAAT),which can increase the dynamic range of the genetic circuit by 6.2 folds,was obtained.Furthermore,by changing the distance between Pdh R Box1 and the+1 position of the promoter,a pyruvate-responsive gene circuit with a dynamic range of 30.7 folds was obtained.Finally,by inserting Pdh R Box1 in the core regions of the promoters Pywj C,Pyte J,and Pyqf D,the lag-log phase-dependent(yte JU and ywj C1)and stationary phase-dependent(yqf DD)pyruvate-responsive genetic circuits were obtained.(2)First,by inserting the binding site of the malonyl-Co A-responsive transcription factor Fap R into the core regions of the endogenous promoter Pfab I and the constitutive strong promoter P43,the malonyl-Co A activated genetic circuit Pfab I,P43FD and P43F1 were obtained.The dynamic ranges of Pfab I,P43FD and P43F1 are 4.2,3.3 and 1.7 folds respectively.After testing,it was found that the malonyl-Co A response threshold of the genetic circuit was50-130 nmol/g DCW,and it had a high specificity for malonyl-Co A.Next,by constructing a P43FD-based Fap R binding site mutation library,combined with high-throughput screening,a mutant P43FD180 with a dynamic range increased to 6.4 folds was obtained(AAAATTGCA TATTATTAGTACCTGGTACTAATA).Subsequently,by regulating the expression level of the transcription factor Fap R,the response threshold of the genetic circuit was modified.Finally,using degenerate primers to construct the Fap R mutant library,combined with high-throughput screening and site-directed saturation mutation,it was found that the arginine at position 106 is the key site for Fap R to bind malonyl-Co A,and its mutation will change the response threshold of the genetic circuit.(3)First,by inserting antisense promoters with different strengths into the 3'end of the Pgrac100-egfp expression cassette,the activity of antisense transcription in B.subtilis was identified.It was found that the inhibitory effect of antisense transcription will increase when the activity of the antisense promoter is stronger.Secondly,we have determined the relative contribution of as RNA and transcription interference to the effect of antisense transcription.The results show that transcription interference is the main regulatory mechanism of antisense transcription.Besides,by combining model predictions and experimental demonstrations,we have revealed that the"self-occlusive"is one of the main mechanisms of transcriptional interference.Furthermore,we used antisense transcription as the"NOT"gate to realize the signal conversion of the gene circuit,thereby constructing the pyruvate/malonyl-Co A inhibitory genetic circuit.In addition,through establishing the mutation library of the antisense promoter,combined with high-throughput screening,we obtained pyruvate-inhibitory genetic circuits yte JU39 and yte JU72 with dynamic ranges increased to 2.8 times and 5.8 folds,respectively.Finally,by replacing the core region and mutating the surrounding sequence of the promoter,a malonyl-Co A-inhibitory genetic circuit with the dynamic range increased to 8.2 folds was obtained.(4)First,by adding Pdh R Box1 to the promoter of the malonyl-Co A-activated genetic circuit P43FD180,the two-input“AND”gate circuits Ayte JU-P43FD180 and Ayte JM-P43FD180 responded to pyruvate and malonyl-Co A were constructed.Their dynamic ranges were 4.4 and 12.5 folds,respectively.Subsequently,by replacing the core region of the promoter,the dynamic range of Ayte JU-P43FD180 was increased to 9.8 folds,and its leakage expression was reduced.Bseides,the original promoter of Pdh R was replaced with the self-inducible promoter P43D1,which reduced the expression noise of the“AND”gate circuit.Furthermore,by adjusting the distance between Pdh R Box1 and the“-35”region of the promoter,the“AND”gate circuits Ayte JU9-P43FD180 and Ayte JUG2-P43FD180 with dynamic ranges increased to9.1 and 17.3 times were obtained.In addition,by connecting the pyruvate-activated genetic circuit and the malonyl-Co A-activated genetic circuit in series,the two-input“OR”gate circuits OP43FD180-yte JU and Oyte JU-P43FD180 responded to pyruvate and malonyl-Co A were obtained.Their dynamic ranges are 4.1 and 4.4 folds respectively.Finally,by changing the distance between the tandem promoters,the expression characteristics of the“gate”circuit were improved,so that it could be completely induced by a single inducer,and the dynamic range was increased to 5.6 folds.(5)First,by integrating the glucaric acid synthesis genes ino1,miox,and udh into the genome of strain B.subtilis,knocking out the competition pathway genes ilo G,yrb E,uxa C and gud D,and overexpressing the pathway gene suh B,we constructed a de novo synthetic pathway of glucaric acid in B.subtilis,and the titer of glucaric acid is 207 mg/L.Subsequently,based on the pyruvate-responsive genetic circuits,a feedback loop capable of dynamically regulating the metabolism network of glucaric acid in response to the intracellular pyruvate concentration was constructed,and the titer of glucaric acid was increased to 527 mg/L.Besides,by monitoring the changes of the intracellular pyruvate concentration and the transcription level of the ino1gene of the strain,it was proved that the function of feedback loop.Furthermore,by blocking the synthesis pathway of acetoin,the titer of glucaric acid was increased to 802 mg/L.In addition,by integrating genes related to the mevalonate pathway into the genome of the vitamin K2 high-producing strain BS17,the supply of vitamin K2 precursor isoprenyl pyrophosphate was enhanced.Meanwhile,the introduction of the mevalonate pathway can increase the metabolic flow of another isoprene pyrophosphate supply pathway(2-C-methyl-D-erythritol-4-phosphate pathway).It shows that there is a synergistic effect between the two pathway.Finally,the genetic circuits were used to cascade control the central metabolism module,precursor IPP supply module,and product synthesis module of the vitamin K2 metabolic network,so that the titer of vitamin K2 was increased to 467.2 mg/L in shake flask,and reached1549.6 mg/L in 50-L bioreactor,which is the highest production of MK-7 ever reported. |
PDF Full Text Request