Effect And Mechanism Of A Disintegrin And Metalloproteinase 17 (ADAM17) On The Biological Behavior Of Gastric Cancer Cells

Objective:To study the ADAM17 expression in gastric cancer and the relationship between ADAM17 expression and the clinicopathologic characteristics and prognosis in gastric cancer patients.Methods:60 surgically removed gastric cancer tissues and 20 normal gastric mucosal tissues were collected in Changshu No.1 People's Hospital Affiliated to Soochow University.ADAM17 expression in gastric cancer and normal gastric mucosal tissues was assessed using immunohistochemistry SP.This study focuses on the analysis of the ADAM17 expression in gastric cancer and the relationship between ADAM17 expression and the clinicopathologic characteristics and prognosis in gastric cancer patients.Informed consent was obtained from all individual participants included in the study.This study was approved by the Ethics Committee of Changshu No.1 People's Hospital Affiliated to Soochow University.Results:78.33% of gastric cancer tissues(47/60)and 15.00% of normal gastric mucosal tissues(3/20)were positive for ADAM17 protein expression.The difference was statistically significant(p<0.01).It showed that ADAM17 protein was highly expressed in gastric cancer tissues.Among the 60 gastric cancer patients,79.41% of the 34 patients aged ? 60 and 76.92% of the 26 patients aged <60 were positive for ADAM17 expression,which demonstrated no statistically significant difference(P>0.05).76.19% of the 21 male patients(16/21)and 79.49% of the 39 female patients(31/39)were positive for ADAM17 expression.No statistically significant difference was observed(P>0.05).As to the gastric cancer lesion location,75.00% of the 16 patients with tumor size ?5cm(12/16)and 79.55% of the 44 patients with tumor size <5cm(35/44)were positive for ADAM17 expression.No statistically significant difference was observed(P>0.05).The infiltration depth of the tumor was limited by the invasion of serosa.64.52% of the 31 patients with infiltration depth of T1T2T3(20/31)and 93.10% of the 29 patients with infiltration depth of T4(27/29)were positive for ADAM17 expression.There was statistically significant difference(P<0.05).77.78% of the 36 patients with lymph node metastasis(28/36)and 79.17% of the 24 patients without lymph node metastasis(19/24)were positive for ADAM17 expression.No statistically significant difference was observed(P>0.05).94.45% of the 18 patients with distant metastasis(17/18)and 71.43% of the 42 patients without distant metastasis(30/42)were positive for ADAM17 expression.There was statistically significant difference(P<0.05).46.67% of the 15 patients with TNM staging phase I and II(7/15)and 88.89% of the 45 patients with TNM staging phase III and IV(40/45)were positive for ADAM17 expression.There was statistically significant difference(P<0.05).In conclusion,in the 60 gastric cancer patients,a positive ADAM17 protein expression was correlated with tumor infiltration depth,distant metastasis and TNM staging,but not with the patient's age,gender,tumor size and lymph node metastasis.Conclusion:1.ADAM17 is highly expressed in gastric cancer tissues.2.A positive ADAM17 protein expression is correlated with tumor infiltration depth,distant metastasis and TNM staging,but not with the patient's age,gender,tumor size and lymph node metastasis,which indicates that ADAM17 gene may play an important role in gastric cancer development.Objective:To study the effect of a disintegrin and metalloproteinase 17(ADAM17)on gastric cancer cell proliferation,invasion and apoptosis capacity.Methods:The siRNA sequence was designed according to the mRNA sequence of ADAM17(Genebank Accession No.: NM₀03183)using a siRNA design website.The primer used was 5'-GATCCAGATCATCGCTTCTACAGATTCAAGAGATCTGTAGAAGCGATGATCTTT TTTTA-3'.ADAM 17-specific sh RNA was designed and then synthesized and sequenced in Shanghai Institute of Bio-chemistry and Cell Biology.The samples rightly sequenced was constructed with plasmid for use.After comparison of the transfection effectiveness using liposome Lipofectamine 2000 and X-treme GENE HP,we decided to use X-treme GENE HP-based ADAM17-sh RNA to transfect human gastric cancer cell SGC-7901.At 72 h post-transfection,the knockdown effectiveness was evaluated using real-time reverse transcription-polymerase chain reaction(RT-PCR)and Western Blot.The effect of down-regulation of ADAM17 expression on human gastric cancer cell proliferation,invasion and apoptosis was observed using CCK8 cell proliferation assay,Transwell migration assay and cell apoptosis assay.Results:After the construction of ADAM17-sh RNA expression vector,we compared the transfection effectiveness using liposome Lipofectamine 2000 and X-treme GENE HP to transfect SGC-7901 cell and tested using fluorescence microscope.According to the optimized result,we chose to transfect SGC-7901 cell in the condition of X-treme GENE HP:sh RNA DNA = 4:1.At 72 h post-transfection,the knockdown effectiveness was quantitatively analyzed using q PCR and validated using Western Blot.The constructed plasmid was found to have effectively down-regulated ADAM-17 mRNA and protein product expression compared to the control group.The invasion capacity of three cell groups was assessed using transwell chambers.In the experiment group,the number of tumor cells that invaded through the transwell chamber was significantly less than that observed in the control group.The absorbance of the membrane at 570 nm was measured to calculate the inhibition ratio.The cell migration inhibition ratio in the ADAM17-shRNA group is 39.85±4% compared to that in the control group(p<0.01)while the cellmigration inhibition ratio in the NC-sh RNA group is 5.26±2% compared to control group(p>0.05).We further evaluated the proliferation of three cell groups using CCK8 assay and drew the proliferation inhibition curve.At 0 and 24 h,the Abs value was not significantly different among the three groups.However,there was an apparent difference in the proliferation of ADAM17-sh RNA cells at 48 h post-transfection when compared to that of the control and NC-sh RNA cells,which gradually increased over time.At 72 h,the difference between the ADAM17-shRNA and control groups was statistically significant(P<0.01),while there was no statistically significant difference between the NC-sh RNA and control groups.These results indicated that the down-regulation of ADAM17 gene expression inhibited apparently the proliferation of the human gastric cancer cell line SGC-7901.We assessed the cell apoptosis of ADAM17-shRNA,control and NC-sh RNA groups with flow cytometry.The results showed a significant increase in sub-G1 phase cell population(cell apoptosis population)in the ADAM17-sh RNA group when compared to in the NC-sh RNA group.The apoptosis rate was 13 ± 2 and 3 ± 1% in the ADAM17-sh RNA and NC-sh RNA groups,respectively(P <0.05).The findings suggested that ADAM17 can inhibit cell apoptosis in gastric cancer and demonstrated the relationship between ADAM17 expression and gastric cancer.Conclusion:ADAM17-shiRNA transfected with human gastric cancer cell SGC-7901 using liposome X-treme GENE HP inhibited ADAM17 protein product expression and then induced an apparent reduction of cell proliferation and invasion capacity and the increase of cell apoptosis,which indicates that ADAM17 gene plays an important role in the development of gastric cancer.Objective:To study the effect of a disintegrin and metalloproteinase 17(ADAM17)on the signaling pathways of gastric cancer cell proliferation,invasion and apoptosis.Methods:We used X-treme GENE HP mediated ADAM17-shRNA to transfect the human gastric cancer cell SGC-7901.At 72 h post-transfection,the knockdown effectiveness was quantitatively analyzed using q PCR and validated using Western Blot.We verified the protein phosphorylation level of EGFR?AKT and ERK1/2 signaling pathways by Western Blot.We examined the cell membrane receptor-bound TNF-? level with flow cytometry.We further evaluated p65,Survivin and caspase-3 protein expression using Western Blot and assessed the relationship between ADAM17 protein expression and the regulation of the EGFR and TNF-? signaling pathways.Results:The study showed that the inhibition of ADAM17 reverses the activation of EGFR signaling pathway,as demonstrated by the reduction of phosphorylation level of EGFR,AKT and ERK1/2.These findings indicated that the inhibition of ADAM17 expression can negatively regulate the EGFR signaling pathway to reduce SGC-7901 cell proliferation and invasion.With the apparent down-regulation of ADAM17 protein expression,the cell membrane bound TNF-? level decreased accordingly.ADAM17-sh RNA group demonstrated a lower cell membrane receptor-bound TNF-? level compared to NC-sh RNA group(36±6%;p<0.01).Western blot was used to evaluate the ADAM17 protein and relative signaling pathway protein expression in different cell groups after ADAM17 konckdown.It was also used to assess p65 phosphorylation,Survivin and caspase-3 protein level.The protein concentration was presented by the grayscale of the band,which showed the change of relative protein expression level.The results indicated that the ADAM17 down-regulation inhibited TNF-? signaling as demonstrated by a reduction in p65 phosphorylation and Survivin protein expression,and an increase in caspase-3 cleavage in cells transfected with ADAM17-sh RNA.These findings suggested that the inhibition of ADAM17 expression can down-regulate the TNF-? signaling pathway,resulting in the pro-apoptotic effect in SGC-7901 cells.Conclusion:ADAM17 protein expression is correlated with the regulation of EGFRand TNF-? signaling pathways and may plays an important role in the gastric cancer cell proliferation,invasion and apoptosis.