The Roles Of MicroRNA-15b-5p In The Function Of Human Vascular Endothelial Cell Through Regulating VEGF Signal Pathway

BackgroundThe activity and function of vascular endothelial cell(EC)are closely related to cardiovascular diseases.Senescence and apoptosis of EC is one of the important mechanisms for the progression of cardiovascular diseases.The maintenance of vascular EC and neovascularization are the key to regulating vascular homeostasis.These cells have numerous important functions such as maintaining blood barriers homeostasis,anti-inflammatory,cytokine producer and antithrombotic effects,etc.The regeneration,apoptosis and aging of EC are involved in the pathogenesis of vascular dysfunction and many diseases,such as acute myocardial infarction,stroke,atherosclerosis,hypertension,etc.To elucidate the molecular mechanisms of endothelial cell in apoptosis and aging,especially dysfunction of endothelial cell,will help to provide new therapeutic targets and theoretical basis for the prevention and treatment of vascular diseases.MicroRNAs(miRNAs)are a class of single-stranded short RNA molecules,around 22nt nucleotides length,encoded by a non-coding region of genes.The mature miRNA is capable of binding the 3'un-translation regions(3'UTR)of messenger RNA(mRNA)in the cytoplasm.The stability and translation efficiency of the target mRNA is affected after the binding of miRNA–mRNA 3'UTR.When mature miRNA bind to the mRNA,RNA-induced silencing complex(RISC)is generated in the region of 3'UTR of target mRNA.RISC blocks the translation of the target gene.Many studies have explored that miRNAs involves in the development and progression of cardiovascular diseases.This is mainly because miRNAs can regulate the mRNA of many physiological functions in cardiovascular diseases,such as cell splitting,proliferation,apoptosis,angiogenesis,migration and wound recover ability of vascular endothelial cells.These functions will affect vascular endothelial repair,such as neovascularization and re-endothelialization,which closely related to the occurrence of various vascular diseases.However,its pathogenesis progress of this whole process remains to be further eucidated.Vascular endothelial growth factor receptor(VEGFR-2)is the ligand of VEGF and abundantly expressed on vascular endothelial cells.This receptor coupled with serine/tyrosine kinase.This receptor controls many crucial signal pathways,for example:PI-3K/AKT signaling pathway.The downsteam pathway requires the biology activity of endothelial cell functions,namely:proliferation,anti-apoptosis,migration,antithrombotic,revascularization,accelerated neovascularization,and repairment of injury accident.ObjectiveCombined with published literatures and large prediction bioinformatics databases(Target scan,Miranda,miRDB),this study aimed to find the potential miRNAs which binded to VEGFR-2.We tried to explore the interference level and mechanisms of these miRNAs candidates to VEGFR-2,and select an optimal miRNA to further analyze its regulation to the VEGFR-2signaling pathway.By study the deep mechanism of miRNA and VEGFR2 will help us to further understand the relationship between miRNA and the physiology function of endothelial cell.This study outcome could be use as a miRNA based target drugs for vascular diseases.Methods1 Predict and validate regulatory miRNAs of the VEGFR-2 GeneCombined with previous literature miRNAs microarray in acute myocardial infarction(AMI)patients and Target-Scan,MiRNAs,miRBase and Miranda miRNA informatics database,we found that Hsa-miR-15b-5p,Hsa-miR-15a-5p and Hsa-miR-497-5p could be abundantly present in the circulating blood of patients with AMI.We used luciferase report assay to test the binding of miRNAs to the 3'UTR sequence in the target gene mRNA of VEGFR-2.2 Synthesis of 3 targets miRNA mimics and miRNA inhibitorsThe sequences of three targets miRNA mimics,single-chain inhibitors and negative controls are as follows:hsa-miR-15b-5p MIMAT0000417(5'-3')UAGCAGCACAUCAUGGUUUACA hsa-miR-15b-5p inhibitors(5'-3')UGUAAACCAUGAUGUGCUGCUA hsa-miR-15a-5p MIMAU0000068(5'-3')UAGCAGCACAUAAUGGUUUGUG hsa-miR-15a-5p inhibitors(5'-3')CACAAACCAUUAUGUGCUGCUA hsa-miR-497-5p MIMAU0002820(5'-3')CAGCAGCACACUGUGGUUUGU hsa-miR-497-5p inhibitors(5'-3')ACAAACCACAGUGUGCUGCUG MiRNA Negative control(5'-3')UUCUCCGAACGUGUCACGUantisense(5'-3')ACGUGACACGUUCGGAGAA3 Generate HUVECs and cell transfection experimentsIn the cell-culture flow cabinet,human umbilical vein were digested with 0.25%trypsin-EDTA.Human primary umbilical vein endothelial cells(HUVECs)were obtained from centrifuge pellet of the digestion.The primary HUVECs were cultured in Endothelial-SFM medium with endothelial cells growth factors and Pen/strep antibiotics.All cells were cultured in a cell culture incubator with 5%CO₂,37?saturated humidity.Each experiment was performed when the cells were passaged at 2-7 passages and reached 80%confluence.MiRNA mimics and inhibitors were transfected into HUVECs by liposomes transfection reagents.All the assays conduct in this study included:negative control group(NC),miRNA group,and miRNA+miRNA single chain specific inhibitor group.4 Morphology,functional and molecular biological assays of HUVECs(1)MTT proliferation assay;(2)Annexin V/7-AAD flow cytometry to detect apoptosis of HUVECs;(3)HUVECs scratch assay;(4)HUVECs angiogenesis assay;(5)Fluoresence quantify qPCR was used to detect mRNA expression level of VEGFR-2,Bcl2,AKT and internal control GAPDH.(6)Western protein bloting for VEGFR-2,phosphorylated-AKT,activated Caspase3 and Bcl2.Results1.Dual-Fluorescence reporter experiments showed that only miR-15b-5p in the three miRNAs candidates had binding activity and could affect the stability of VEGFR-2 mRNA;2.MTT assay found that the miR-15b-5p miRNA could inhibit the proliferation of HUVECs.3.Apoptosis of HUVECs was detected by Annexin V/7-AAD flow cytometry.Apoptotic cells significantly increased after overexpression of miR-15b-5p.4.MiR-15b-5p supressed the wound repairment ability and angiogenesis of HUVECs.5.MiR-15b-5p could regulate the expression of AKT mRNA and protein by affecting the expression of mRNA and protein levels of VEGFR-2 in HUVECs,and miR-15b-5p inhibitor could specifically inhibit this process.6.MiR-15b-5p induced HUVECs apoptosis through up-regulated expression of activated caspase3 protein,meantime Bcl2 mRNA and protein expression was down-regulated.Conclusion1.MiR-15b-5p was able to bind 3'UTR of VEGFR-2 mRNA,thus cell proliferation,migration,angiogenesis were down-regulated in HUVECs.2.MiR-15b-5p could regulate and affect various biological functions of HUVECs by regulating the expression of mRNA and protein of VEGFR-2,AKT,Caspase3 and Bcl2.3.MiR-15b-5p single chain inhibitors could inhibit the negative regulatory effect of mir-15b-5p,and it is promising to become a drug for the treatment of vascular endothelial cell injury caused by excessive expression of mir-15b-5p.