| Objective: Periodontitis is a chronic infectious disease that invades the periodontal support tissues.Periodontitis is considered to be an independent risk factor for the development of Alzheimer ’s disease(AD).Porphyromonas gingivalis(P.gingivalis),an important periodontal pathogen,and its virulence factors such as lipopolysaccharide(LPS)and gingipain are detected in the central nervous system of patients with neurodegenerative diseases.Gingipains can be detected in the cerebral cortex of AD patients and confirmed its co-localization with hippocampal neurons.The toxin-free and pathogen-free environment of the central nervous system(CNS)is maintained by the blood-brain barrier(BBB).The related factors that determine the permeability of the blood-brain barrier include tight junctions(TJs)in the paracellular pathway,transcytosis and transporters.Among them,transcytosis includes clathrin-mediated transcytosis and caveolae-mediated transcytosis.Caveolae biogenesis is dependent on caveolin-1(Cav-1)and cavins,a support protein family.Major Facilitator Superfamily Domain Containing Protein 2A(Mfsd2a)is essential for maintaining normal BBB.Mfsd2 a mainly plays a role in the transcellular transport process mediated by the cell membrane.Mfsd2 a specifically inhibits caveolae-mediated transcytosis.Excessive increase of transcytosis can lead to blood-brain barrier dysfunction in the central nervous system.Our previous results have found that P.gingivalis can enhance BBB permeability by enhancing the transcytosis mediated by the cell membrane caveolae of BBB brain microvascular endothelial cells.However,the specific virulence factors of P.gingivalis are not clear,and the regulatory mechanism of its virulence factors such as gingipains on Mfsd2 a and Cav-1 is still unclear.The purpose of this study was to investigate the regulation of gingipains on the above pathways and BBB permeability and its related mechanisms,and to provide new strategies for the prevention and treatment of early AD-like cognitive impairment.Methods:1.The effect of gingipains on AD-related behavior and pathological changes in mice.In the animal experiment,C57BL/6 mice were randomly divided into 4 groups,namely the P.gingivalis group,gingipain group,P.gingivalis LPS group,and control group,with 10 mice in each group.The P.gingivalis group was injected with P.gingivalis at a dose of 100 CFU per injection,the gingipain group was injected with gingipain at a dose of 0.36 μg/kg,the P.gingivalis LPS group was intravenously injected with P.gingivalis LPS at a dose of 72 μg/kg,and the control group was intravenously injected with 50 μL of PBS.Injections were given 3 times per week for 8 consecutive weeks.The Morris water maze and novel object recognition tests were performed to evaluate the effect of P.gingivalis,gingipain,and P.gingivalis LPS on AD-related learning and memory in mice.The pathological changes in the hippocampus and cortex of mouse brain tissue were observed using hematoxylin-eosin staining.Immunofluorescence was used to detect gingipain in the mouse brain.Immunohistochemical staining was used to detect tau protein tangles in the hippocampus.2.The effect of gingipains on BBB permeabilityWe used Western blot to investigate the effects of P.gingivalis,gingipain,and P.gingivalis LPS on the levels of serum albumin in the hippocampus and cortex of mice.MRI was used to evaluate the effects of P.gingivalis and gingipain on BBB permeability in vivo.The in vitro BBB model was constructed.P.gingivalis and its virulence factors were added to the upper chamber of Transwell for 24 h.After changing the medium,FITC-dextran 70 was added to the upper chamber for 24 hours.The amount of FITC-dextran 70 in the lower chamber was detected after 24 hours,and the passage of bacteria in the lower chamber was detected by agar culture method.The effect of P.gingivalis virulence factors on the permeability of brain microvascular endothelial cells(b End.3)was detected by flow cytometry.3.The effect of gingipains on the expression of Cav-1 and Mfsd2 a in the transcytosis pathway of brain microvascular endothelial cells.We used Western blot to investigate the expression levels of the tight junction proteins occludin and Mfsd2 a in the hippocampus and cortex of mice after treatment with P.gingivalis,gingipain,and P.gingivalis LPS.Immunohistochemical staining was used to detect the expression levels of Cav-1,a key protein involved in transcellular transport,in the hippocampus and cortex of mice.The b End.3 cells were infected at different time points to observe the expression of Mfsd2 a m RNA and protein.b End.3 cells were treated with P.gingivalis and its virulence factors to observe the expression of Mfsd2 a and Cav-1 m RNA and protein.The expression of Mfsd2 a in b End.3 cells treated with different concentrations of gingipains and P.gingivalis LPS was observed.4.The role and possible mechanism of Ddx3 x in the regulation of Mfsd2 a expression by gingipainsThe bEnd.3 cells were treated with gingipains for 24 hours,and the expression of Ddx3 x protein was observed.Mass spectrometry analysis was used to screen the proteins with methylation modification after gingipains treatment;the threedimensional structure of Ddx3 x protein docking with gingipains Rgp A was simulated by computer.The b End.3 cells were transfected with overexpression Ddx3 x plasmid,and then treated with Rgp A for 24 hours after stable expression of the plasmid.The expression of Mfsd2 a m RNA and protein were observed.Results:1.Gingipains promote AD-related behavior and pathological changes in miceIn the Morris water maze test,the escape latency of C57BL/6 mice in the P.gingivalis group [72.23(65.67,85.24)s](P =0.002)and gingipain group [84.52(62.45,90.06)s](P <0.001)was significantly increased compared to the control group [7.99(5.75,10.26)s].There was no significant difference in the escape latency between the P.gingivalis LPS group [12.01(10.00,20.24)s] and the control group(P >0.05).In the spatial exploration test of the Morris water maze,the number of times the mice crossed the platform within 90 seconds was significantly reduced in the P.gingivalis group [1(1,1)](P <0.01)and the gingipain group [1.5(1,2)](P <0.05)compared to the control group [5(2,9)].However,there was no significant difference in the number of times the mice crossed the platform between the P.gingivalis LPS group [6.5(3,9)] and the control group(P >0.05).In the novel object recognition test,the preference index(P.I.)of the P.gingivalis group P.I.(0.48±0.14)(P <0.001)and the gingipain group P.I.(0.56±0.18)were significantly lower than that of the control group P.I.(0.81±0.14).There was no significant difference in the P.I.between the P.gingivalis LPS group P.I.(0.92±0.07)and the control group(P >0.05).The results of hematoxylin-eosin staining of mouse brain tissue showed that intravenous injection of P.gingivalis,gingipains,and P.gingivalis LPS caused vacuolar degeneration,nuclear condensation,and disordered cell arrangement in the neurons of the hippocampus and cortex.Vascular dilation was observed in the cortex.Gingipains were detected in the neurons of the hippocampus and cortex in the P.gingivalis and gingipain groups.Immunohistochemical staining showed that there were significant tau protein tangles in the hippocampus and cortex of the P.gingivalis group,gingipain group,and P.gingivalis LPS group(P <0.01).The P.gingivalis group and gingipain group exhibited significantly higher levels of tau protein entanglement than the P.gingivalis LPS group(P <0.001).2.Gingipains increase BBB permeabilityIn the animal experiment,Western blot results showed that intravenous injection of P.gingivalis and gingipains significantly increased the level of albumin in the hippocampus of mice compared to the control group(P <0.01).However,intravenous injection of P.gingivalis LPS had no significant effect on the level of albumin in the hippocampus of mice(P >0.05).Similarly,the level of albumin in the cortex of the P.gingivalis group and the gingipain group was significantly higher than that in the control group(P <0.01).There was no significant difference in the level of albumin between the P.gingivalis LPS group and the control group(P >0.05).In vitro,we found that after adding P.gingivalis into the upper chamber of the BBB model in vitro for 24 hours,the characteristic black colonies of P.gingivalis can be cultivated after collecting the lower chamber fluid.The fluorescence signal of FITCdextran 70 leaking from the upper cavity to the lower cavity can be detected in the P.gingivalis group and the gingipain group(P<0.001).After treatment of brain microvascular endothelial cells for 24 hours,P.gingivalis can be detected to internalize into brain microvascular endothelial cells.We also found that compared with the control group,gingipains,P.gingivalis inactivated bacteria and P.gingivalis LPS can promote FITC-dextran 70 to enter into brain microvascular endothelial cells(P<0.05).In terms of increasing the permeability of brain microvascular endothelial cells,gingipains > P.gingivalis inactivated bacteria > P.gingivalis LPS.3.Gingipains inhibited the expression of Mfsd2 a and promoted the expression of Cav-1In the animal experiment,immunohistochemical staining and Western blot results showed no significant difference(P >0.05)in the expression of the Occludin protein in the hippocampus and cortex of mice after intravenous injection of P.gingivalis,gingipain,and P.gingivalis LPS.Western blot results of mouse brain tissue showed that intravenous injection of P.gingivalis and gingipains significantly decreased the expression levels of the Mfsd2 a protein in the hippocampus and cortex(P <0.05).Immunohistochemical staining showed that P.gingivalis and gingipains significantly increased the expression of Cav-1 in the brain microvascular endothelium of the hippocampus and cortex of mice(P <0.01).In vitro,the effect of P.gingivalis on the expression of Mfsd2 a was time-dependent(P<0.001).Gingipains can significantly reduce the expression of Mfsd2 a m RNA and protein in brain microvascular endothelial cells(P<0.05),and this effect is dosedependent.In addition,gingipains can significantly up-regulate the expression of Cav-1 m RNA and protein in brain microvascular endothelial cells in vitro(P<0.05).However,there was no significant difference between inactivated P.gingivalis and P.gingivalis LPS.4.Gingipains regulates the expression of Mfsd2 a in brain microvascular endothelial cells through Ddx3xWestern blot analysis showed that the protein level of Ddx3 x in brain microvascular endothelial cells treated with Rgp A was significantly lower than that in the control group(P<0.001).RBPsuite deep learning software predicted that the Ddx3 x protein was predicted to bind with the 421-490 base sequence of Mfsd2 a m RNA(ccctttctct gcctccatca tcctgtgtgtgggccgagcc tgggatggcca tcagaccc cctgtggc).After overexpression of Ddx3 x,the expression of Mfsd2 a m RNA and protein was significantly up-regulated(P<0.05),and the overexpression of Ddx3 x significantly reversed the decrease of Mfsd2 a m RNA and protein levels caused by gingipains stimulation(P<0.05).After the treatment of Rgp A,it was found that the demethylation of Ddx3 x protein Arg363-Arg376(amino acid sequence RIVEQDTMPPKGVR)in brain microvascular endothelial cells was modified.The docking structure of Ddx3 x protein(Uniprot ID Q62167)and Rgp A protein(Uniprot ID P28784)was analyzed by computer simulation.It was found that Rgp A and Ddx3 x protein had a strong binding effect.There are 306 sites in total,including Ala490 site of Rgp A protein and Arg362 site of Ddx3 x protein,Glu365 site of Rgp A protein and Arg376 site of Ddx3 x protein,which can be combined in the form of hydrogen bond,and the interaction distance is less than 4 ?.And the two binding sites were highly consistent with the demethylation sites Arg363-Arg376 on Ddx3x protein.The results indicated that these two proteins can form a tight complex,which may affect the methylation modification of Ddx3 x protein after binding.Conclusions:1.Gingipains increased the permeability of blood-brain barrier and reduced the learning and memory and cognitive function of mice.2.Gingipains inhibited Mfsd2 a and up-regulated Cav-1 to increase blood-brain barrier permeability.3.Gingipains might increase the permeability of blood-brain barrier by inhibiting the expression of Mfsd2 a mRNA through Ddx3x. |
PDF Full Text Request