Cloning And Expression Of HER2/neu ECD In Pichia Pastoris

her2/neu gene encodes the production of 1255 amino acids and molecular weight of 185kDa. It concluds signal peptide,extracellular domain ,transmembrane domain and intracellular domain. Signal peptide is located in the amino-terminal and consisted of 21 amino acids; extracellular domain is consisted of 632 amino acids and mainly consisted of cysteine ; transmembrane domain is consisted of 22 amino acids and have the property of hydrophobicity. HER2/neu oncogene is a member of the tyrosine protein kinase family of oncogene and shares a high degree of homology with the epidermal growth factor receptor. HER2/neu appears to induce malignancies through quantitative mechanisms that result from increased or deregulated expression of an essentially normal gene product. Approximately 25 to 30 percent of breast cancers overexpress HER2/neu. Extracellular domain of HER2/neu is located on the surface of cells so it is the target of anti-tumor therapy. Herceptin is a humanized and mouse-resource monoclonal antibody. It belongs to a group of drugs made in the laboratory that are designed to attack specific cancer cells. This kind of antibody also has the heterology and can produce HAMA(human anti mouse antigen) in many difference levels. The majority of tumor vaccines are mainly tumor peptides, they have the merits of convenient operation and high purity but the drawbacks are present simple antigen peptide and immune response located certain area can induce immune tolerance. In this study we cloned and expressed HER2/neu ECD in order to expose all CTL peptide epitopes ,TH and B epitopes. Prokaryotic expression of HER2/neu ligand recombination domain of HER2/neu extracellular domain was reported. But the recombinant protein is in the form of inclusion body and need purification and renaturation to become soluble protein with biological activity. Through this process the output of the recombinant protein decreases dramatically. Moreover, ligand recombination domain of the extracellular domain only has CTL antigen epitopes,and has not many TH antigen epitopes. According to the mentioned problems,we chose the Pichia pastoris to express recombinant protein. Pichia pastoris is unicellular eukaryotic organism, and it is used for expression recombinant protein in recent years. The benefits of expression recombinant protein base on the following merits: the strong alcohol oxidase (AOX) promoter can control the foreign gene to express strictly; it can culture with high density but require low nourishment which is benefitial for industrial manufacture; it has very few self secrete protein and do good to purification for foreign protein; the foreign gene is stable when it is transformed to the chromosome of the Pichia pastoris; it can process and decorate the expression protein, methylotrophic yeasts have the ability to use methanol as a sole source of carbon and energy. Up until now expression HER2/neu ECD in Pichia pastoris is not reported. In order to express human recombinant HER2/neu ECD in Pichia pastoris we did some work as below: The construction of human recombinant HER2/neu ECD expression system 1.The construction of cloning vector contains HER2/neu ECD gene HER2/neuECD cDNA was cloned from SK-BR-3 cell line (HER2-overexpression human breast cancer cell line) through reverse transcription polymerase chain reaction (RT-PCR 5'primer 5'-GGACTCGAG CTAACCCTCTTGCCC 3'prime5'-ACGATCGATGGACGTCAGAGGGCT).The ECD DNA was subcloned into a PBS clone plasmid. The recombinant vector was identified by restriction XhoI and ClaI digestion. The result showed that the new recombinant HER2/neu ECD cloning vector was constructed successfully. DNA sequencing results showed that the cloning vector contained the complete gene sequence of HER2/neu ECD. 2.The construction of expression vector contained HER2/neu ECD gene The construction of expression vector contained HER2/neu ECD gene Taking the cloning plasmid pBS-ECD as the template, PCR(5'primer 5'-CAACTCGAGAAGAGAAGCACCCAAGTGTGC 3'primer5'-CCATCTA GACTTAGGACGTCAGAGGGCTGG) amplified the DNA of interest. We constructed a expression plasmid pPICZαconsisting of HER2/neu ECD gene. The recombinant vector was identified by the digestion of restriction XhoI and XbaI. The result showed that the new recombinant HER2/neu ECD expression vector was constructed successfully. DNA sequencing results show that the expression plasmid pPICZα/ECD contained the correct reading frame. 3.Transformation of the recombinant plasmid ,identification of the positive clones and the expression of the recombinant protein. Mixed 80ul of the fresh competence of yeast cells with 5～10μg of linearized pPICZαDNA(in 5～10μl sterile water) and transfered them to an ice-cold (0℃) 0.2cm electroporation cuvette. Spread 50～100μl each on separate, and labeled YPD plates containing (25μg/ml) of Zeocin. Incubated plates for 2 to 3 days at 28℃until colonies formed. Selected positive transformants and cultured them in BMGY separately. When the Pichia pastoris cultured in logarithmic phase took 1ml culture liquid to extract the genome DNA of Pichia pastoris. And the HER2/neu ECD transformants were assayed via PCR with no-transformant as antitheses. The result showed all transformants have the DNA fragment of 1900bp but the antitheses has no...