Font Size: a A A

PICln Gene Cloning, The Eukaryotic Expression Vector Construction And Polyclonal Antibody Preparation

Posted on:2009-11-13Degree:MasterType:Thesis
Country:ChinaCandidate:Z C HanFull Text:PDF
GTID:2120360242980563Subject:Biochemistry and Molecular Biology
Abstract/Summary:PDF Full Text Request
pICln(p-protein , I-currents , Cl-chloride , n-nucleotide sensitive) is closely with the chloride ion electric current related, and the nucleic acid-sensitive protein. It is one kind of late discovery chloride ion channel candidate protein, can lead the chloride ion outflow which swelling causes by the volume, and has the remarkable function in the cell multiplication, the RNA cutting body assembly, also in the cell skeleton's movement. Its cDNA was in 1992 cloned by Paulmichl et al. from the pig kidney epithelial cell (MDCK cell), carried on the experiment through the fixed-point mutagenesis to the extrapolation structure, discovered that this cDNA coded one kind the small molecular protein which was composed of 235 amino acids. The experiment extrapolated that pICln is the dimer structure, the monomer constitutes 4 Beta - folding structures by 31-87 amino acids.The recorded chloride ion electric current from African fingernail toad ovocyte injected with the pICln mRNA may suppressed by ATP and so on single nucleotide in varying degree. pICln in the big mouse heart, the ovocyte of the African fingernail toad and the MDCK cell, mainly distributes in the soluble butcher nature ingredient, probably occupies 70%-80%; 10%-20% in nucleus; less than 5% in microsome. The MDCK cell's immunity histochemistry dyeing result had also shown pICln mainly exists in this cell in the butcher nature. pICln in Raja embryo's heart and in MDCK cells had the close molecular dimension, raises under the normal condition, 90%+/-4% exist in the butcher nature ingredient. pICln mainly distributes in the butcher nature in the above cell, but in human reticulocyte through the laser scan fluorescence microscope observation immunity group dyeing, presented pICln mainly to distribute obviously on the amnion.Generally speaking, pICln in many kinds of organizations, and many kinds of cells hasn't only the expression, but in the different kind also has highly the homology, explained that it has the important function. But present research on it is also insufficient, for example whether pICln is the chloride ion channel candidate protein or the butcher nature adjustment protein has not been determined. Although the"anchor≒insertion"model mechanism may explain the above question, but also lacks the reliable evidence at present. Moreover, although pICln play the influential role in the cell swelling which causes by the volume, but the function mechanism was still not clear. Unclear to the pICln function mainly stems from insufficiently understanding to its structure thoroughly, because the pICln contents are extremely few in the cell, in the normal condition it is very difficult to separate and purification, which brought the very great difficulty to the research. Based on above reason, in this experiment we constructed the pICln goal gene to the eukaryon expression vector pGAPZα-A, on the one hand the constructed reorganization plasmid particle can be possibly highly effective express the goal protein in the pichia yeast, and can secrete outside the cell, convenient for the following separation purification; On the other hand, after the eukaryon expression has avoided the protein structural change, activeness lose and so on shortcomings in the prokaryotic expression, favors for the the active detection to reorganized protein.Through GENEBANK we got the pICln the CDS sequence of the Norway big mouse, designing the upstream primer and downstream primer. Upstream: 5'TG/AATTCTTGGTTCCTGTGGAGCAATGC 3', the transverse line is the EcoRI enzyme cuts spot; Downstream: 5 ' AC/TCGAGCACGAGTCA TCCTCAGTGGTC 3 ' the transverse line is the XhoI enzyme cuts spot. Extract the total RNA from the Norway big mouse kidney, increase the goal fragment through two steps RT-PCR, 1% agarose gel electrophoresis examination, it has the obvious specificity banding about 760bp, with theoretical value match case. After purification by DNA fragment recycling reagent box, connected with the cloning vehicle pMD18-T, transformation the competence cell of Ecoli JM109, after blue white screening, choice masculine gender clone. Because the preparatory work was full, achieved the aseptic technique basically, therefore the result is good. There are 264 single colonies in the plate, 254 white colonies among, choose 5 white colonies to make the enzyme stochastically to cut the appraisal, there are 4 colonies connected successfully, conversion rate approximately above 80%. Extract the reorganized plasmid from the masculine colonies, after the double enzyme cuts with EcoRI and XhoI, separated the fragments with 1.5% agarose gel electrophoresis, we got the special bandings in 2.9kb and 760bp place, cuts 760bp which place needs goal banding, after recycling reagent box purification, connected with the Pichia yeast expression vector pGAPZα-A which also cut by EcoRI and XhoI. Transformed competence cell, cultured in the LB medium contain with Zeocin. When the masculine colony grew, cut down the fragment with our two enzymes to the appraisal, electrophoresis with 1.5% agarose gel, we saw clearly two specificity bandings in 2.9kb and the 760bp place under the UV lamp. The results has proofed the we had constructed the eucaryon expression vector with Pichia. In order to obtain the anti-pICln protein specificity anti-body, we synthesized 19 amino acid members of pICln protein carbon terminal. As a hapten, to increase the immunogenic, connected with crosslinking agent PVP, then we has the hypodermic multi-spot immunity to the male otter rabbit. Divided four times for the immunity, the cycle is 6 weeks, in the first three immunity the mixed antigen contain with the completely type adjuvant, the last time with the uncomplete type adjuvant. 6 weeks later, heart puncture bloodletting, After offcenter, the blood serum was purified by the salting out preliminary, using indirect-ELISA and Western-blot separately to detect the titer of the blood serum. In the ELISA examination, the immune body titer is 1:6400. The Western-blot examination shown that the specificity of the anti-body is perfect, and we had the clear banding in 43KD place.At present in the home besides my advisor, there are not the pICln protein related reports yet, using the Pichia to express the reorganized protein hasn't been reported oversea yet. Therefore our experiment's innovation and the research prospect are very big. Laid the solid foundation for the further study of the pICln structure and the function later.
Keywords/Search Tags:Chloride ion channel, pICln, Multi-clonal antibody, vector construction
PDF Full Text Request
Related items