| BPI,also known as bactericidal/permeability-increasing protein,is a 55kD cationic antibacterial glycoprotein found in PMNs.BPI selectively exerts multiple anti-infective activities against gram-negative bacteria,neutralizes gram-negative bacterial lipopolysaccharide(LPS) and so on.It was found that the N-terminal fragment of BPI has identical activities with full-length of BPI.Presently,BPI is considered as a new promising antibacterial and LPS neutralizing drug in the future.The pig and the cow were choosed as experiment animals.It was an aim to clone and express porcine and bovine bactericidal/permeability increasing proteins N-terminal fragment by molecular clone technology.These experimental results provide the scientific theory and foundation for the further study of biology function of BPI in pig and cow,and for the development of recombinant biology preparation which prevents G- infectious diseases.1 Cloning and analysis of sequence of BPI N-terminal fragmentThe density gradient centrifuge was used to separate neutrophil granular cell of the pig and the cow.Trizol Reagent was adopted to extract the RNA from PMNs of the pig and the cow.According to the gene sequence of BPI of the pig and cow which registered in GenBank(pig:AF252874,cow:BC102310),two pairs of primers were designed respectively(Pig P1:CGGAATTCATGACTTTGACCTGAGTGTGG AGGGC,P2:GCGTCGACTTACAGGCTGCTGCCGGACG;Cow B1:CGGAATTC ATGGCCAGAGGCCCTGAC,B2:GCGTCGACTCAAGGTGCCACCAGTGAGTA A).For the purpose of the directional clone and the appraisal of BPI N-terminal fragment,EcoRâ… and Salâ… sites and the corresponding protection basic group were designed at 5'-terminal of upstream primers and downstream primers respectively.A 146bp and a 714bp were amplified by reverse-transcription polymerase chain reaction. Purified products were inserted into multiple cloning sites of plasmid vector pGEM-T-easy,formed recombinant plasmid,which was transformed into E.coli DH5a,positive clone plasmid was screened with Amp resistance screening.The recombinant plasmid were sequenced.These results strongly suggested that recombinant plasmid was constructed successfully.The results suggested there was a basic groups mutated in pig and cow respectively compared with the reports,but amino acid sequence of two kinds of animals was consistent with the reports respectively.The DNAstar analysis software was adopted to analyze obtained gene fragments of the pig and the cow.The result showed there were 81%homology between porcine BPI N-terminal fragment from 2 to 146 and bovine BPI N-terminal fragment from 446 to 590,and there were 75% homology of amino acid sequence.2 Procaryotic expression of BPI N-terminal fragmentIt was essential for ligasing to digest porcine and bovine BPI N-terminal fragment and bacterial plasmids pGEX-4T-1 by EcoRâ… and Salâ… ,then which were ligased at the ration of 3:1,formed recombinant plasmid,which was transformed into E.coli BL21,positive clone plasmid was screened with Amp resistance screening.The recombinant plasmids named pGEX-BPIp,and pGEX-BPIBwere identified by double restriction enzyme analysis and PCR methods.The recombinant fusion protein was expressed in the form of inclusion bodies in E.coli BL21 induced by lmmol/L IPTG.The molecular weight of the fusion protein is about 32kD and 52kD including GST 26kD.After the inclusion bodies of fusion proteins were purified with washing buffer for Several times,they were dissolved by the denaturing buffer.Then the fusion proteins were purified by hitrap affinity columns,and obtained a good result by analysis of the SDS-PAGE and the ultraviolet spectrophotometer,and obtained the concentrations of the fusion protein:pig,0.028mg/ml;cow,0.030mg/ml.It is successful to clone and express porcine and bovine BPI N-terminal fragment firstly by molecular clone technology.The study is helpful to further research in the role of recombinant BPI and lay a substantial foundation for its clinical applications to the treatment of G- infectious diseases. |