The Micro Stem - Loop Structure Of Cis- Elements Plays A Key Role On Gene Activation

Objective: Differentiation and senescence are the main function features of eukaryotic cells. A large number of non-protein coding DNA and repetitive sequences are structural features of the multicellular eukaryotic genome, and there may be some kind of inner link between these function features and structural characteristics. Studying of the mechanism of non-protein coding DNA how to regulate gene expression and finding a new biological function of non-protein coding DNA will be an important help for understanding process of differentiation and senescence.The structure of non-protein coding DNA plays an important role in the regulation of gene expression. VDJ recombination of B lymphocytes needs palindromic sequences. In addition stem-loop structure is involved in viral transcription, replication and other biological processes. Bioinformatic analysis find that single-stranded DNA of human genome is also complementary in the level of the small fragment (string), and thus indicates that palindromic sequence (which can form a stem - loop structure) in the DNA is widespread. Our experiments find that a 17bp sequence (5'-AAAAAAATGCTTTATTT) from SV40PolyA when it is inserted into downstream of GFP gene can activate gene expression and has a stem - loop structure. This paper is to prove what is the function of such a structure in regulating gene expression, and whether is it a new biological function of non-coding sequence. For narrative convenience, we will name the stem - loop structure as micro stem-loop, and use it to refer to a 3bp loop and a 3bp stem in DNA sequence which can activate gene expression.Methods:1 Synthesis of primers and DNA fragment as template: The primers with the suitable restriction sites were synthesized from DNA synthesis companies, and template DNA fragment with different mutations was synthesized. Artificial synthetic oligonucleotide sequence and its name used in paper are in Table 1.2 Construction of recombinant plasmids: The objective DNA fragments which included plasmid DNA sequences and synthetic DNA fragments were PCR amplified using primers with the suitable restriction sites. The PCR fragments were inserted into pEGFP-C1 vector to generate an expression vector with the fragments. Primers were designed with EcoRⅠ/XbaⅠrestriction enzymes sites on the upstream and KpnⅠ/ NheⅠon the downstream (Table 1). Cohesive terminals of XbaⅠand NheⅠwere ligated by T4 DNA ligase, but XbaⅠnor NheⅠcan neither digests the ligated products. Using these character tandem recombinant plasmids were constructed by inserting the repeat segments into pEGFP-C1. Expression vector used in this paper is in Table 2.3 Cell transfection and fluorescence microscope observation: The expression vectors were transiently transfected into HeLa cells using lipofectamine TM2000.GFP expression in HeLa cells was observed by fluorescence microscopy.4 Northern hybridization: Using the 9N random primers and large fragment of E. coli DNA polymerase, theα-32P-dCTP was incorporated into DNA to prepare probe for GFP. Total RNA of HeLa cells transfected was extracted, electrophoresed and transferred to the nylon film. Hybridization with GFP probe and autoradiography were performed. Then the nylon film was treated with removal liquid, and was again hybridized with the probe for neo RNA, autoradiography as transfection efficiency control.Results:1 Identification of recombinant plasmids: The recombinant plasmids were initially proved to be correct by the restriction digestion analysis, PCR analysis and the length of the inserted fragments was consistent with the expected one. The recombinant plasmids were finally confirmed by DNA sequencing. Sequencing results of the expression vectors in this experiment are showed in Table 3 and Fig.1, all of them are correct.2 Deletion of 2F2R impacts on the gene activation: In this article we studied the sequence which was from SV40PolyAas sequence (240bp). The SV40PolyAas sequence was divided into some 60bp, which were respectively named as 1F1R, 2F2R, 3F3R and 4F4R (their location and sequence shown in Fig.2A). 2F2R was inserted between GFP and Alu of pAlu14 sequence and relieved GFP gene expression that was suppressed by Alu14. In order to make clear which part of 2F2R can activate gene, we analysis it by deleting parts of 2F2R (Fig.2B).3 The effect of 2F2R 3'end deletion on the gene activation: Base pairs in 2F2R 3 'end were deleted, the monomer or two tandem body was inserted into downstream of GFP gene of pAlu14 plasmid, transfected cells and Northern blot results are shown in Fig.3.As it shown, the influence on gene activation is decreased, with increasing the number of deletion of bases in both of the monomer and two tandem body. The effect of 19R and 16R on gene activation can be negligible. And the ability of the two tandem bodies is higher than their corresponding monomers. Besides, base deletion and series connection also affected the position of transcription termination, low molecular weight transcripts and high molecular weight transcripts of single 45R account for 1 / 2 respectively, but low molecular weight transcript accounts for the main of the two polymers 45R (This may be because the series make the enhanced role of the termination site).The low molecular weight transcripts is obviously in the two polymers 19R, and it is different from the monomers19R. Both of 30R and 22R in monomers and two polymers are mainly high molecular weight transcripts.The other two sequence of 2F2R, Poly4 and Secloop, the monomer and two tandem bodies of them are inserted into pAlu14 (the Northern test results in Fig. 2B). Both of them have no effect in gene activation.The difference between 17ntAT and 22R is the deletion of upstream "5'-GTG" and downstream "GT-3 '". 17ntAT, missing upstream three bases of 22R and downstream two bases of 22R, still activates gene expression, and the amount of transcript is not less than 22R, indicating that the deleted five bases for the gene activation is not important. 19R was resulted from deleted three bases downstream of 22R( "TGT-3 "), transcription is significantly decreased, indicating that the third base(T)from downstream of 22R is essential for transcription. On the basis of the 19R, and then removing the next three bases from downstream of 22R (ATT-3 ') is 16R, transcription level is further reduced. The same as the other sequences, the transcription of 17ntAT two repeats is higher than the monomer. Although the five bases from 22R upstream and downstream have no effect on transcription, they obviously promote transcription elongation because 22R produces high molecular weight transcripts compared with 17ntAT.4 The series connection of 30R and Poly4 enhances the effect on gene activation: 30R can activate gene expression (Lane1) compared with Alu14 (Lane5), Poly4 can not activate gene expression (Lane2) compared with Alu14 (Lane5). 30R in series with the Poly4 synergistically activated gene expression (Fig.6A, Lane1-6) compared with Alu14 (Lane5). 30R downstream connect with Poly4 and its effect is higher than 30R (Lane3, 4), indicating that Poly4 can strengthen the role of 30R. 30R-Poly4 is inserted by restriction site (15 bases, Fig.6B) in the middle compared with 2F2R, due to the 15 bp insertion so that the amount of high molecular weight transcripts is increased, and the total amount of transcripts is decreased.5 The inserted base number between two 22R influencing the gene activationWe used the 22R that is "5'GTGAAAAAAATGCTTTATTTGT" to study the 17bp sequence, because the base composition of the restriction sites would also impact on the role of the 17bp sequence. Upstream "GTG" and downstream "GT"can reduce the impact of the restriction sites to a certain extent. We changed the number of bases between the two 22R and observed the effect of them on gene activation (base sequence shown in Fig.7B), indicating the number of bases between the two 22R has no significant effect on gene activation (Fig.7A).This feature is different from the comparison between 2F2R and 30R-Poly4 series body (the role of gene activation of 0 bases connection is higher than 15 bases connection). Two bases is in the middle (Fig.7A, Lane3), and 15 bases (Fig.7A, Lane9), led to a clear emergence of high molecular weight transcripts.6 Changing the base type of loop and the number of bases of loop impacting gene activationThe fragments that were changed in the loop base type and the loop length of 22R, were inserted into pAlu14 plasmid and Northern hybridization was done to observe GFP gene expression (changes in base sequence shown in Figure 8B, hybridization results of GFP probe shown in Fig. 8A ).The loop of TGC (22R*2, wild-type) is the most to activate gene expression, the GTC and TCC are less than TGC, the GCA is least effective to activate gene expression. Compared with the number of bases of loop ranged from 0 to 6, the type of three bases (22R*2, wild-type) is the most to activate gene expression, and too much or too little of loop bases decreases gene activation. Notably, the TGC (22R, wild type) produces high molecular weight transcripts in the seven recombinant plasmids of different numbers of loop bases, only TGC (22R, wild type) produces the most high molecular weight transcripts compared with the other four plasmids of different base type of loop.7 stem - loop structure related to gene activationMutation of 17bp sequence (5'AAAAAAATGCTTTTTTT, 4T) is equivalent to remove the bubble between the two stems, and the complementarity of stems is more solid so that the effect on gene activation was lost (Fig.9A, lane 2). And if mutation of "AAAAAAA" at the same time, 5'AAATAAATGCTTTTTTT (to make bubbles recovery), is to restore the effect on gene activation (Fig.9A, Lane1); this lack of complementary sequence such as 5'AAAAAAATGCAAAAAAA and 5'TTTTTTTTG CTTTTTTT is no effect on gene activation (Fig.9, Lane 4,5 ).Conclusion:1 17bp sequence of 2F2R 60bp is the core sequence of gene activation by deletion analysis. 2 Although Poly4 dose not activate gene, but it can enhance the effect of 30R on gene activation.3 The two tandem repeats of 45 R, 30R, 22R are more effective of gene activation than their monomer.4 The number of connection bases between the two repeats has an effect on gene activation.5 Of the loop base types and base numbers of 17 bp core sequence, wild-type, "TGC" and three bases, has the most effect on gene activation.6 17 bp sequence structure affects gene expression, and too little and too much complementary are not favorable to activate gene expression.7 Of the length of the stem of 17 bp core sequence, wild-type (three bases) has the most impact on gene activation.