Isolation Of Degrading Microbe Of Organophosphrous Pesticides And Studues In Its Properties

It is visible that pesticide can enhance yield of crop every year, at the same time, we should not forget that it is endangering our environment and health. Organophosphate pesticide dimethoate is accepted because of its excellences such as low toxicity, short rudimental time, easy to volatilization and degradation, etc. But it still heavy endangers our environment because of long time and large using. So, It is very important to find a good way to ravel out the contamination from dimethoate.Among several degradation mode of dimethoate, microorganism degradation is the most important. We isolated a passel of microorganism from soil polluted by dimethoate for many years. There were over 200 bacteria strains and over 100 fungal strains totally. They all could grow on culture medium without any other C except dimethoate. By more isolation and domestication, we obtained five bacteria strains which could grow on culture medium with very thick dimethoate, so we named them L-a, L-b, L-c, L-d and L-e. We determined degradation activity of these five bacteria strains by gas chromatographic(GC) techniques, results showed that they all occurred high rated biodegradation. In 48h, L-a reached 468mg/L, L-b l,431mg/L, L-c 904mg/L, L-d 994mg/L, and L-e l,494mg/L. To L-b, the optimum temperature, pH and maximum tolerance to grow on dimethoate were 28-30℃, 7.0 and I0,000mg/L respectively, and it still grown well in 18-42℃ and pH6.0-pH9.0. We identified L-b by ITS(internal transcribed sequence) sequence. When PCR, primers were showed blow: 16SF, 5' AGTCGTAACAAGGTAGCCGT 3' ; 23SR: 5' GTGCCAAGGCATCCACC 3' , then the produces of PCR were cloned and sequenced, and searched in GenBank+EMBL+DDBJ+PDB database, as the result, we...