The task screened and selected the epiphyte producing astaxanthin from leaf mold soil of different places, and through the identification of epiphyte configuration and fermentive products, roughly considered it a kind of a red yeast. Through further screening it, the epiphyte with high output of astaxanthin, which is 397.0ug/gCDW. With the 18Srna technique, and on the base of epiphyte 18SrRNA conservative sequencies, tow primers, which are18SF: 5'CCAACCTGGTTGATCCTGCCAGTA3' and 18SR 5'CCTTGTTACGACTTCACCTTCCTCT3', were designed. In the way of PCR, we amprified a 1774bp sequency of 18SDNA containing 46.96%G+C, and in Genebank compared it with 18SDNAs of other critters, further convinced that the epiphyte is Rhodotorula glutinis, called Rhodotorula glutinis SJ by us.With electric-transform technique, and under the impulse transform condition of 2.0kV 25μF 200Ω, put genome DNA of Haematococcus pluvialis into Rhodotorula glutinisSJ and with filtrating model of anilin and CuSO4, gained a transformant with the pigmental output of 772 ug/gCDW, which is as 1.95times as that of parental R.g SJ. With microbe morphologic and RAPD technique , we made a fringe identification of inherited background of the transformant. In microbe morphologic, Haematococcus pluvialis, Rhodotorula glutinisSJ and its transformant were compared on clones. On molecular biology, we had optimized PCR reactive systems and conditions , and screened 1 saldom primers (168) from 23 ones. Through RAPD analyzing this on three materials given, bands of parents amplified by primer S168: there are Haematococcus pluvialis DNA and Rhodotorula glutinisSJ DNA in the transformant. Results showed that the transformant contains geneon DNA of Haematococcus pluvialis. With spectrophotometry, under the condition of wavelength 474 nm, content of astaxanthin of the transformant and that of its parents are tested; Results showed that the transformant has the highest biomassof three ones, but its pigmental content is lower than that of Haematococcus pluvialis.In order to approve the productive stability, experiments were done on the productive stability of successive 8 generations . Results showed: the fouth generation was the highest biomass, and the first one the lowest, and there are the discrepancy of 6.25% in their biomass , 1.31% in their pigmental contents and 6.25 % in their pigmental outputs and herediry of the transformant is comparatively stability. Above-mentioned transforment has thr biomass of 1.52g/100ml , which is higher 54.3 times than that of its parent— Haematococcus pluvialis, and its growth cycle is shorter 12days than Haematococcus pluvialis,and its content of active amylase is 140.35 mg/lOOmL, which is higher 10.3% than its parent—R.g-SJ,and at the same time,it is rich in, Vb, ergosterol and protian and other creative substances .
|