Font Size: a A A

The Molecular Mechanism Of Quinolones Resistance Of Aeromonas Hydrophila

Posted on:2003-09-03Degree:MasterType:Thesis
Country:ChinaCandidate:W ZhengFull Text:PDF
GTID:2133360092980236Subject:Prevention of Veterinary Medicine
Abstract/Summary:
Aeromonas hydrophil is a bacterial pathogen which leads to various disease of fish, amphibian, reptile, birds and mammal. As quinolones are lower price, little side effect and resisting bacteria effectually, they have been used broadly. Unfortunately drug resistance to quinolones was developed in A. hydrophil shortly after the introduction of these agents. Here we report the study of the mechanism of quinolones drug resistance of the becteria.The doubt forty-six A. hydrophil isolates were isolated from fishes collected from 12 water regions in Jilin province. Biochemical tests and amplify aer gene with PCR were utilized to identify the A. hydrophil isolates. Among forty-six isolates tested, 22 strains were identified as A. hydrophil and 4 drug resistant strains were identified by drug-resistance routine agar diffusion test and minimal inhibiting concentration test. Norfloxacin, ciprofloxacin and ofloxacin resistance were verified. The identified strains, including 6 susceptible and 2 resistant strains were cultured in LB, washed with physiological saline, centrifugaled at indoor temperature, dyed with phosphorus wolfram acid, observed on electric microscope and compared the surface structure. Many small globles, which were similar in size, were observed on the surface of the 2 drug-resistant strains. By contrast, this structure was not observed on the surface of the 6 susceptible strains.The genome of four drug resistant strains, two susceptible strains were amplified by PCR. The primers, AI: AGAGTTCCTATCTTGATTACG; A2: CTGTGATGTAGGTCATCAACT; B,: GGACGAGCTCTGCCGGATGTG; B2:GATGCCATACCTACCGCGATA, were synthesized according to the gyrA gene sequence of A. salmonicida, which amplify the quinolones resistance-determining region of the gyrA gene. 588bp PCR products were cloned into vector pMD18-T, the recombinant vectors were transfered into the E. coli DH5 a competent cells, which were incubated on ampicillin plates with X-Gal and 1PTG at 37 C overnight. The white clones were selected and incubated.After identification, the sequences were determined and analysised by DNA star software. Four mutation sites of amino acid sequence were found, which were serine 83-to-isoleucine, leucine 92-to-methionine, isoleucine 174-to-phenylalanine and an adjacent site asparagines; leucine 202; 203-to-asparatic acid; arginine.In order to get the full sequence of gyrA gene of A.hydrophil, the standard A. hydrophil conserved in our labortary was incubated, and chromosomal DNA was isolated with the method of mixed phenol-chloroform extraction procedure. Then the DNA was digested by BamH I and 2 - 4 kb restriction fragments were isolated from LMP agarose gels electrophoresis. The pUC19 vecter was prepared by the alkaline lysis procedure, digested by BamH I and CIAP. The 2-4 kb chrolosomal DNA fragments and the pUC19 vecter were ligated with T4 DNA ligase. The ligated mixture were transformed into the competent E. coli DHs a to generate selected genomic DNA library. The liberary size is 2.7x 106 recombinants. The liberary screen is being conducted and the result will be reported later.
Keywords/Search Tags:A. hydrophil, quinolones, drug resistance mechanism
Related items