The male sterility play a key role for tomato production. Some CMC lines have been introduced from Bulgaria and one inbred line named 383 has been selected for the further analysis and mapping in this study. The results from open field proved that this line gave a very stable sterility in Beijing climate. The advantage of ps-2 line was easy to obtain the progenies with 100% sterility. F1 hybrid restores the fertility and easily used for tomato production. In order to assist tomato breeding, PCR markers derived from tomato RFLP mapping have been used to map this gene comparing the genetic linkage map, which has been mapped in tomato chromosome 4. Four probes combined with 17 restriction enzyme has been used to identify the polymorphism. Probe CT269B gave the polymorphism between female and male parents after digested respectively by TaqI,DraI and HindIII. The newly designed PCR primers derived from tomato probes including Tg506(5'>cgcctgtgacctgtcctaa<3'/5'>ctgaaatggccaaagttgt<3'),Tg652(5'>atggccaaacaattgaacc<3'/5'>tgcatgccatgacttctca<3'),Tg516(5'>caaaaggctaggccaggaat <3'/ 5'>ggcacttcgcaaaactgaat <3') produced the polymorphism between female and male parents. Among them, Tg65 was proved the tightly linkage with ps-2 gene by using F2 segregated population. The linkage distance is about 13.75 cM. In addition, four plasmids have been transferred into E. Coli. The stability of CAPs markers have been tested. All the above work will be benefit for the further research.
|