Moleculor Identification Of The Seed Borne Pathogen Causing Black Spot Of Cabbage And Study Of Control Chemicals In Vitro

Aimed at the regions coding for 5.8s rDNA and the flanking internal transcribed spacers(ITSl and ITS2) from 20 domestic and foreign isolates belonging to three species of Alternarla brasslcae, A.brassicicola, A.japonica and the related species, the study amplified with universal primer pair ITS4 and ITS5, cloned , sequenced ,aligned and analyzed phylogenetic relationship. Using three specific primers pairs designed and synthesized depending on the sequence information identified the three Alternaria species separately. In need of effective control chemicals in cabbage production measured the median effective concentrations (EC50) of 14 fungicides on four Altemaria strains.The alignment of the DNA sequences of the internal transcribed spacers ITS1 and ITS2 and 5.8s rDNA showed the base composition of ITS1 is more variable than that of ITS2 among the species and also the length of ITS1 varied more than that of ITS2. In spite of from different regions and different hosts base composition of ITS1 and ITS2 has major variation and not for sequence length for different strains of each species. Phylogenetic analyses of ITS1 and ITS2 aligned sequence reveals all strains of each species from different locations and different hosts formed a clade which can distinguish obviously from the other by the related species.Three specific primers pairs are designed depending on the sequence information, the primer pairs Abrel (AGGCTGAAATCTCTCGAGACGA) and Abre2 (AAGGCGAGTCTCCAG -CAAACTA) can amplify specifically the 371bp fragment of Alternaria brassicae, Abral (ACCTCAGCAGCATCTGCTGTTG) andAbra2 (GGCTTTATGGATGCTGACCTTG) primer pairs for 457bp fragment of A.brassicicola specifically and AjapK AGCAGTGCATTGCTTTACG -GCG)and Ajap2 (CCAGTAGGCCGGCTGCCAATT) primer pairs for 411bp fragment of A.japonica. the three primers pairs can identify them separately and can been used as a molecular marker .A comparative study was conducted to evaluate the effect of medium, temperature, pH, and light duration on mycelial growth rate and colony characteristics ofA.brassicicola,A.brassicae and A.japonica. The results indicated that PDA was the optimum medium whereas SNA could be a selective medium for Alternaria. The three species could be differentiated on different media based on colony diameter. The optimum growth temperatures of the three species ranged from 20℃ to 25℃, with those of A.brassicicola and A.japonica 5℃ higher than previous reports. The pH range of mycelial growth was from 4 to 8 for domestic strains of A. brassicae while from 3 to 11 for all others. Light duration had little effect on the growth rate of domestic isolate of A.brassicae and A.japonica. However, the growth rate of the other strains was significantly higher under 24h light or 12h alternate light than that under 24h darkness.Studies on the inhibitory effect on mycelial growth disclosed that the sensitivity to fungicides of the strains from the same or different regions has notable difference. Among them Iprodion, Difenoconazole and Tebuconazole show best inhibition and the distinction of the sensitivity of all strains on Iprodion is not obvious and the In vitro median effective concentrations (EC50) ranged from 1.2108ug/ml to 2.8863 ug/ml, but it is obvious on Difenoconazole and Tebuconazole, the EC50 of Difenoconazole from 0.1275ug/ml to 7.0968ug/ml., and Tebuconazole from 0.7069ug/ml to 2.8863ug/ml.