The Cold-resisdance Of Cassva And Preliminary Investigation For Breeding Of Cassava

Cassava, belonged to Euphorbiaceae, is a shrubby perennial cop and grown in many areas of tropics and sub-tropics in China. In recent years, cassava was one of the raw materials for the fuel ethanol producted, and lots of cassava industry shows huge development potential. However, transplanting cassava into north of China was limited by the non-cold resistance. Therefore, the research of breeding cold hardiness cassava has become an important task for the present research. In this paper, the research of breeding cold resistance cassava was deeply studied. Our objectives were establishing the system of cold hardiness breeding, which include selecting the cold-resistance germplasm of cassava, the techniques of embryo rescue and assessment of the cold resistance of filial generation. Based on this research, the SAD gene of the filial generation of cassava was cloned. The results provided the theoretic and practical scientific data for the cold resistance research of conventional cross breeding and transgenic breeding.The main results were as follow:1 The Survey and Analysis of cassava's fruit setting in Guangxi province:The number of inflorescence, branch and fruit of 80 varieties of cassava in Wuming country of Guangxi province were surveyed. The results showed that 73.75%of 80 cassava varieties could be normal flowering; 95.00%could branch naturally and 47.50%could fruit normal. The SAS software analysis indicated that there was the positive correlation between the number of inflorescence and the number of branch.2 Screening the genetic resources of cold resistance:the degree of colors'change of seed stem was observed and the electrolyte of blade was determined, which from 38 cassava varties in Guangxi province, and screening 4 cold resistance varties which were SC6,D346,E144 and B1.3 The technology of cassava embryo rescue:The explant was established by the rate of brown stain and pollution of explant. Experiment showed that embryo could be the material of embryo culture, which was recovery when the flower was pollinated after 30 days. A modified medium consists of 1/3MS+0.5mg/L 6-BA+3 mg/L AgNO3+0.5mg/L IBA+20 g/L sucrose that suitable to indefinite bud from embryo was acquired by complicate selection to each elements affecting culture. Based on it, Higher frequent indefinite bud have been obtained from embryo of four varieties(lines), and the average rate of induction was 53.3%. Among this varieties(lines), E144 was the best with 56.7%. The experiment showed that callus was induced by NAA easier than 2,4-D by complicate selection to each elements affecting culture. A modified medium consists of 1/3 MS+8mg/L NAA+20g/L sucrose that suitable to callus induction from embryo was acquired. Based on those higher frequent callus have been obtained from embryo of four varities(lines), E144,D346,SC6,B1.AndE144 is the best with 62.5%.4 Assessing the cold-resistance and Identifiving relationship of the F1 generation: Six preferably cold-resistance plant of F1 generation was screened by observing the degree of permanent and turning colour of blades which is from twenty-one plant of F1 generation,and assessing the cold-resistance physiological index by using the way of Delphi. The experiment show that higher branch persition and bigger branch angle,which is observing the main character of six higher cold-resistance plant of Fl generantion.At last,the relationship of six plant of F1 generantion was found out by using cluster analysis.5 Cloning and bioinformatical analysis of SAD gene of F1 generantion:The total DNA was extracted from the blades of regeneration plant of F1 generation. One pair of primer P1(5'TGGCTCTCAAGCTCAATCCT3')and P1'(5'TCTCGGCCATCATA CATCAA3') were designed according to the conserved nucleotide sequence of SAD which was from J.curcas and Arabidopsis thaliana, by Blast on NCBI. PCR was performed with primer and the genomic DNA of cassava, And one 361bp gene fragment was selected. The result showed that the gene sequences of the six F1 generantions had a high similar, and the SAD gene fragment of cassava shared highe nucleotid sequence identity with SAD gene from J.curcas and Ricinus communis by identity analysis. The nucleotid identity with J.curcas is up to 92%and with Ricinus communis is up to 82%.