Extraction And Purification Of Chromatin Assembly Associated Proteins And Heat Shock Induced In Vitro Transcription Of Hsp90α Gene On Chromatin Template | Posted on:2006-05-26 | Degree:Master | Type:Thesis | Country:China | Candidate:H Dai | Full Text:PDF | GTID:2144360152481776 | Subject:Pathogen Biology | Abstract/Summary: | PDF Full Text Request | Objective :Histone proteins, assembled with DNA to form nucleosomes, are the basic building blocks of chromatin. The eukaryotic genome is packaged into chromatin, which not only constrains the genome within the boundaries of cell nucleus but also permits dynamic and broad-ranging changes related to many important biological phenomena. That is to say, in addition to wrapping DNA, the most important role of chromatin is "turn-on/turn-off "DNA efficiently by remodeling its structure, consisting of covalent modification of histone and ATP-dependent chromatin remodeling complex. In recent years, specific covalent modifications on histone tails have been characterized, including acetylation, phosphorylation, methylation, ubiquitination and SUMO, which correlate with gene regulation. It was known as "histone code",which becomes a considerable epigenetic genetic mark. For the purpose of research the effect of post-translational modifications of histone and correlation between different modifications further more ,we found a system to assemble chromatin in vitro. Each nucleosomal unit is formed by wrapping approximately 146 base pairs of DNA around a histone octamer core particle containing one H3-H4 tetramer and two H2A-H2B dimmers. Many studies indicated that many chaperone participate the formation of nucleosome, most of which are conjugated protein with core histone. For example, nucleosome assembly protein-1 (NAP-1) can help DNA to wrap with histone by combining with H2A and H2B prior. On these grounds, we separated core histones from HeLa cell by chromatography with hydroxyapatite. To transfect Sf9 cells with baculovirus, then express and purify NAP-1. Hsp90 is one of the most important members in Heat Shock Protein (HSP) family. It is high constructive expression in cells, by which heat shock or other stress condition will induce expression. HSP90 also helps the maturation, transportation and activity regulation of some hormone receptors, transcription factors, kinases and nitrogen monoxide synthase. Thus HSP90 plays a wide and important role in the cells, and its expression regulation study is of physical importance. We construct a transcription in vitro system, utilizing competitive RT-PCR-based technique quantify the promotor activity of hsp90αgene on chromatin or naked DNA templates in vitro. The core histone methylation is a major player in the gene expression. The tail of H3/H4 is methylated by histone methyltransferases (HMTase). To date, there are five lysineswithin histone H3(K4,K9,K27,K36,K79)and one lysine within histone H4(K20)that have been shown to be methylated by specific histone lysine methyltransferases(HKMTase), and the methylation effect of these sites are different. Methylation at H3-K9,H3-K27,H4-20 associated with repression, but methylation at H3-K4,H3-K36,H3-K79 associated with active .On the same site , monomethylation,dimethylation and trimethylation has different effect .So we acquire a method of histone methylation to research the existing cross-talk among histone methylation and other histone covalent modifications and DNA methylation further more. Methods: (1)Preparation of whole cell extract . HeLa cells were harvested with trypsin. Cytomembrane and nucleolemma were split by lysis buffer and homogenization, and ultracentrifugated 45000rpm for 3 hours. The pellet was used to extract core histone like discription of step (2); while in supernatant excess ammonium sulphate was added in order to precipitate proteins. After centrifugation, the precipitation was resuspended in optimally buffer. The intrant ammonium sulphate was removed by dialysis. (2)Purification of core histone . The hydroxyapatite resin was swelled and equilibrated with solution buffer, and packed it into column. The pellet from ultracentrifugation above-mentioned was resuspected into solution buffer, and then makes it flow through the column. Additional 3-4 times volume solution buffer was used to wash the column. After that, basic histones were eluted with highconcentration salt-solution. Collecting the elute solution to Eppendorf tube in order. The concentrations of histones in each tube were calculated by BCA assay. Every fraction was run on a 15% SDS-PAGE gel. The core histones could be stored at -80℃for several years.(3)Extraction of NAP-1. Sf9 cells were infected with recombinanted baculovirus at MOI<1 and incubated at 27℃for 3 days to amplify baculovirus. The virus was harvested by aspirating the supernatant and the titer of it was tested. Then Sf9 cells were infected with baculovirus at MOI>10 to express the protein. The infected Cells were harvested after 3 days and lysed by Lysis buffer. After centrifugation, the supernatant was combined with 50% Ni-NTA resin that had been equilibrated to the Lysis Buffer overnight. The resin was washed twice with Lysis Buffer, then twice with Wash Buffer. The protein was eluted by Elution Buffer for four times. The pooled protein sample was dialyzed for 4 hours against Dialyzation Buffer. ( 4 ) Chromatin assembly. The plasmid DNA wrapped core histone into nucleosome with the help of chaperone such as NAP-1,ISWI/Acf1. In order to confirm that chromatin assembly is successful, micrococcal nuclease was used. Micrococcal nuclease is an enzyme that digests DNA in between nucleosomes. If chromatin was assembled, after the digestion 200 bp ladder should be seen in agar gel. (5)Detection CAT reporter gene driven by the promoter of hsp90αgene. RT-PCR was performed using a pair of primers specific to CAT, 5'gaggcatttcagtcagttgc 3', 5'cccgccctgccactcatc 3'to amplified the gene fragment of CAT. The production was separated by 1.5% agar gel .The ratio of gray scale between purpose band (588bp) and input (286bp) band can indicate the activity of reporter in in vitro transcription(6)Histone methylation. Histone was combined with 3H-methyl by methyltransferases PRMT. It was precipitated with TCA, and then analyzed by SDS-PAGE and autoradiography. Results : (1)Core histone was extracted and purified from HeLa.(2)NAP-1 was expressed with recombination baculovirus expression vector system in Sf9 cell and extracted. (3) A new in vitro transcription system was constructed. In this system, we found that the transcription level of both pBLCAT3α1 and pMCAT was high when the amount of whole cell extracts was 6μg. (4) The in vitro transcription efficiency of heat shock-treated whole cell extracts is obviously higher than that of control whole cell extracts at same amount. (5) In vitro chromatin assembly was carried out with purified components of chromatin assembly associated factors, core histones and CAT reporter gene driven by the promoter of hsp90αgene. Chromatin was digested by micrococcal nuclease, and then several ladders could be seen in agar gel electrophoresis, which indicated that chromatin assembly was successful. (6) In this transcription system, the transcription level of hsp90αon chromatin template was lower than that on naked DNA. (7) The heat shock induced transcription of...
| Keywords/Search Tags: | histone, NAP-1, whole cell extract, in vitro transcription, RT-PCR, chromatin assembly, histone methylation | PDF Full Text Request | Related items |
| |
|