Study On Variant Genotypes Of CCR2-64I,SDF1-3(?) And CCR5△32 In HIV-1 Infected Chinese Long-term Nonprogressors

ObjectiveThe objective of this work is to study on the association between variant genotypes of CCR2 -64I, SDF1 -3'A and CCR5 Δ32 and HIV - 1 infected long - term nonprogressors of China . In our experiments, we first assay the variant genotypes of CCR2 -64I,SDF1 -3'A and CCR5Δ32 in HIV - 1 infected long -term nonprogressors of China.Methods1. Study objectsSubjects from two different cohorts were included in our study: a cohort of LTNP, and a cohort of standard progressors(TP). Fifty - six untreated HIV - 1 infected patients were from Liaoning , Jilin Province in HAN Chinese population. Blood samples were collected and serologic status was determined by ELISA ( Vironostika, Organon Tednika, The Netherlands ) with confirmation by Western blot ( Genelab Diagnostics, Singapore). Seventeen LTNP remains a-symptomatic and clinically healthy for at least ten years and their amount of CD4 + T cells remain above 500/ul. Thirty - nine TP infected HIV - 1 within 5-8 years. Some have clinical symptoms . CD4 +T cells varied within 6/ul -1137/ ul.2. CD4 absolute countThe 20ul TriTEST reagents CD4/CD8/CD3 was added to the CD4 absolutevial and 50ul whole blood was added then. After a 15 - min incubation at room temperature, the erythrocytes were lysed using FACS lysing solution. After another 15 -min incubation at room temperature, the vials were taken to perform FACS analysis by using Multiset software. The absolute count and the percentage of CD4 + ,CD8 + and CD3 + T cells were calculated automatically.3 . Extraction of Genomic DNA samplesGenomic DNA samples were obtained from 200ul peripheral whole blood u-sing Magna Pure LC Total Nucleic Acid Isolation Kit with automatic apparatus for isolation of total nucleic ( Magna Pure LC) .4. Genotyping assay of CCR5Δ32 allelesThe presence of the CCR5Δ32 allele was determined with a polymerase chain reaction (PCR) - based assay. The 225 - bp fragment was amplified u-sing 5 'ACCAGATCTCAAAAAGAAGGTCT 3 ' and 5 'CATGATGGTGAAGATA-AGCCTCACA 3' as forward and reverse primers respectively. The amplification conditions were the same for all three tests. Briefly, initial denaturation at 94℃for 3 minutes, followed by 30 cycles of 94X1 for 1 minutes,55℃ for 30 seconds and 72℃ for 1 minutes, followed by a final extension step at 72℃ for 10 minutes. PCR amplified products were separated in 2. 0% agarose - gel electro-phoresis.5. Genotyping assay of CCR2 -64I allelesThe presence of the CCR2 -64I allele was determined with PCR/RFLP assay. The 379 - bp fragment was amplified using 5 'GGATTGAACAAGGA CG-CATTTCCCC 3' and5 ' T GCACATTGCATTCCCAAAGACCC3' as forward and reverse primers respectively. PCR amplified products were digested with restriction endonuclease ( BseGI) by 55℃for 2 hours and then separated in 2. 0% agarose - gel electrophoresis.6. Genotyping assay of SDF1 -3A allelesThe presence of the SDF1 -3'A allele was determined with PCR/RFLP assay. The 305 - bp fragment was amplified using 5 ' CAGTCAACCT-GGGCAAAGCC 3'and 5' GAAAGCTTTGGACCTGAGAGTCC3' as forward and reverse primers respectively. PCR amplified products were digested with restriction endonuclease ( MspI ) by 37℃ for 2 hours and then separated in 2.0% aga-...