| CVB3 is the most frequent pathogen that causes viral myocarditis(VMC). VMC is the main etiopathogenisis of children acquired heart disease, it can also induce many diseases such as children cardiac rhythm, backward heart failure and sudden death. At present, the onset of VMC has an elevated tendency year by year. Just like many viral infection diseases, owing to be short of the specific antiviral drugs, VCM that is caused by CVB infection can not get utility and promptly therapy. Now many medical experts all over the world try to find new antiviral drug with the technology of moleculat recognition., this technology has more specificity and can depress and eliminate the infected capability of virus through the binding of two ligands. Phage peptides display developing recent years provide more efficient method for screening neotype molecular recognition drugs. In this research , we screened ligands on intact CVB3 virion by display libraries of phage to find specific polypeptides which bind CVB3 with high affinity and inhibit replication of CVB3, and provided new evidence for the production of polypeptide drugs against CVB3 infection. Objective Find specific polypeptides which can inhibit replication of CVB3. Method 1. Cultivation and amplification of CVB3 Resuscitating Hep-2 cell, then added CVB3 to a culture flask full of monolayer of cells. When CPE appeared in the cells above 80%, removed the cell culture medium to a container, amplificated in this way till the amount was 1000ml.. 2. Purification of CVB3 In order to get rid of the cell component, the culture solution of virus was frozen and dissolved alternately for three times and condensed it by PEG8000, then pure viral partical was obtained by sucrose density gradient centrifugation.. 3. Screening polypeptides binding CVB3 with high affinity with phage peptide library Cultivating host bacterial BL21, coating 96 wells with CVB3. Gonging on 3 circles screening, taking records of input and output, calculating yield of every round.. 4. Preparation of phage positive clone Taking the 3th screening recovery fluid to prepare phage positive clone. 5.Detecting the inhibitition of CVB3 replicationThe mixture of CVB3 and phage peptides was added to Hep-2 cell, observing each day, then calculating TCID50 of each group, finding specific polypeptides which bind CVB3 with high affinity and inhibit replication of CVB3. 6.DNA sequencing Extraction DNA of the positive phage clones to sequence their DNA. Result 1.The result of the viral culture and propagation. Normal Hep-2 cell present the shape of long shuttle, adding CVB3 to Hep-2 cell, afer incubated 24-48h, conspicuous cytopathic effect appeared with cell rounding,fusing and shedding. 2.The result of screening After 3 circles screening, we gained phage positive peptides which binding CVB3 with high affinity successfully. 3.The result of DNA sequencing The DNA sequences of three peptides are CCGGGCGCGAGCCCC AAGGTCGGCGAC; ACCGGGCGTGAGCCGCAAGGTCGGCGA; TTCACCGGGCGTCAAGTC CAAGGTCGG. In turn, the amion acid sequence is Pro-Gly-Ala-Ser-Pro-Lys-Val-Gly-Asp;Thr-Gly-Arg-Glu-Pro-Gln-Gly-Arg-Arg;Phe-Thr-Gly-Arg-Gln-Val-Gln-Gly-Arg. Discussion CVB3 is a kind of small RNA virus, it can cause many viral infective diseases. At present, the onset of VMC has an elevated tendency year by year. Searching specific medicine has very... |