Font Size: a A A

Novel Effect Of PPARgamma Ligand On Cardiomyopathy And ANP MRNA Expression In Streptozocin-induced Diabetic Rats

Posted on:2007-10-01Degree:MasterType:Thesis
Country:ChinaCandidate:H WuFull Text:PDF
GTID:2144360182987152Subject:Internal Medicine
Abstract/Summary:
Diabetes is one of a wide spread metabolic disease in the world now. The number of the patients are increasing remarkably. Cardiovascular complications are the main complications of DM, which has the direct relation with the mortality. There are many evidences showing the existence of the diabetic cardiomyopathy in the diabetic patients, ruling out the ischemic, valvular or hypertensive heart disease. The diabetic cardiomyopathy is not a single pathological change probably. It is one of the diabetic complications which has the feature of the dysfunction and structure changes of the myocardium and coronary artery system. There are many arguments about how the diabetic cardiomyopathy causing the decreasing of the heart function in these patients. One opinion is that the diabetic cardiomyopathy increases the degree of the myocardial ischemia, the other opinion is that it alters the wide metabolic activity of the cardiac muscle. Peroxisome proliferators-activated receptor agonists, such as rosiglitazone, can increase the sensitivity of the insulin so as to lower the blood glucose. Antiproliferative, anti-inflammatory and immunomodulatory actions are also the important role of this matter. In the clinic, PPARgamma ligands have showed the salutary effects in limiting infarct size, attenuating myocardial reperfusion injury and benefit in patients with diabetes and heart failure. Atrial natriuretic peptide (ANP), which is secreted by cardiac atrium and ventricle, has the ability of diuresis, dilatingblood vessel and antagonizing renin-angiotensin system. Now there are many experiments showed that the plasma ANP concentration is elevated in congestive heart failure coming from myocardial ischemia, hypertension and some idiopathic diseases. In this experiment, we investigated the ultrastructure of myocardium and the alteration of the ANP in the diabetic rats. At the same time, the action of the PPARgamma ligand on them was also studied.Materials & MethodsExperimental Animals1. Studies were carried out in 50 Sprague Dawley(SD) rats (male 25,female 20), 10 weeks old, offered by Zhejiang University Animal Laboratory Center.2. The animals were housed in animal quarters kept at 20°C to 22°C with a 12-hour light/dark cycle and were allowed free access to chow and water throughout the study.3. SD rats were divided into two groups: Experimental group was treated with intraperitoneal injection of 3 ml of STZ 60mg/kg diluted with pH 4.5 sodium citrate buffer. The control was treated with a single intraperitoneal injection of 3 ml of sodium citrate buffer, 0.1M, pH 4.5. We divided them into two subgroups, one of which was raised for 6 weeks and the other was raised for 10 weeks. 10 of 10 weeks diabetic rats were given ROS lmg/kg/d through intragastric administration (Corporation: Glaxosmithkine) dissolved in normal saline.4. Urine glucose of these rats were tested daily and blood glucose was checked every week from tail vein (American Adantage). If urine glucose was less than +++ (positive reaction), no treatment was given;If urine glucose was ++++ or more, 1 ~ 3 iu of protamine zinc insulin was injected subcutaneously to prevent the occurrence of ketoacidosis, nonketotic hyperosmolar diabetic comma and even death in these rats.5. After 6 and 10 weeks treatments, all rats (except 2 rats died during experiment)were anesthetized by intraperitoneal injection of ketamine (35mg/kg) and phenobarbital (50mg/kg). Ventricles for making specimens of transmission electron microscope and atriums for detecting ANP mRNA expression were cut down, both about 5mm><5mm large.Making specimens of transmission electron microscope1. Ventricular tissue was fixed in 2.5% glutaraldehyde after washing by 0.2M PBS. And then tissue was dealt with in a sequence of being washed by 0.1 M PBS, fixed by 1% osmic acid for one hour, dehydrated by alcohol of 30%, 50%, 70%, 80%, 90% and 100%, and at last dehydrated by 100% acetone. Anhydrous acetone and embedding medicinal preparation mixed according to 1:1 volume permeated organization, and vibrated for 2 hours.2. Mixtures were put into the drying oven to let acetone volatilize and pure embedding medicinal preparation embedded them. The next day after embedded by pure embedding medicinal preparation, tissues were put into polymerizer . first 37°C for 24h,then 45 °C for 24h,and 60°C for 48h at last.3. Tissue trimming and thick sectioning: Trim excess resin from the side or top of the block face. And made the block face to form a broad trapezoid, the top edge being smaller than the bottom. Thick sections are cut for one to three-micron-thick (ultramicrotome) from the embedded blocks by using a glass knife and placed them onto glass slides. The sections are stained with 0.1% toluidine blue.4. Thin sectioning: Make the glass knife by LKB-7800 knifemaker. The top and bottom edges of the trapezoid were made parallel to the tissue sample. Thin sections about 120nm were cut from the thick section slides and placed onto clean 200-mesh copper grids.5. The grids are then stained with uranyl acetate and lead citrate, rinsed and placedinto grid holders. At last the sections were blotted by filtrate paper.6. All sections were observed under the Philips TECNA10 transmission electron microscope.RT-PCR Assay of ANP mRNA ExpressionSample preparation and RNA extraction: Atrial tissue was stored at -80°C until analysis was begun. Put the tissue into triturator and grind it. Total RNA was extracted from collected cells using the Trizol Reagent-Total RNA Isolation Reagent. The resulting RNA concentrations were estimated spectrophotometrically by measuring the absorbance at 260 nm. Primer and Probe sequences(1) ANP mRNA:forward primer: 5'GAGAGCGGACTAGGCTGCAA3' (456-555) reverse primer: 5TCAGTGGCAATGCGACCAA3' (597-606) probe: 5'CGGTACCGAAGATAACAGCCAAATCTGC 3' (523-591)(2) p-actin:forward primer: 5'-TCACCCACACTGTGCCCATCTATGA-3' reverse primer:5'-CATCGGAACCGCTCATTGCCGATAG-3' probe: 5'-ACGCGCTCCCCCATGCCATCCTGCGT-3'Real-time PCR was performed with Line-gene Detection System (made in Japan). The degree of expression ANPmRNA was normalized to 6—actin as internal control.Ct ANP mRNA ANPmRNA= --------------------------------------------------Ct p-actin mRNAStatistical analysis:Experimental values were expressed as mean±SD. Analysis of variance was done by SPSS 10.0 for windows One-Way ANOVA. P<0.05 was considered significantly difference and P<0.0l was considered very significantly.ResuItRats' weight:The DM rats' weight loss compared with that of the control was obvious (PO.01). The weight of DM rats treated by ROS increased compared with that of the group without ROS, though the glucose level was still high in DM treated by ROS. Especially, the weight gain of the female DM rats treated by ROS compared with that of female DM without ROS treated was significant (PO.05).Rats' glucose concentration:Diabetic rats induced by STZ had hyperglycemia (P<0.01) compared with the control. The bizarre result was that the glucose level of DM treated by ROS was higher than that of DM without ROS, but P>0.05.Ultrastructure of rats' myocardium under transmission electronmicroscope1. Normal rat's myocardial cell ultrastructure of 6 and 10 weeks:The sarcoplasm contained aplenty myofilament bundles and mitochondria both of which were well arranged. Z line, A band, M line, H band and I band were distinct. The clear and well-arranged cristae showed high cellular oxidative metabolic rate. Lots of mitochondria had full cell membrane and gathered near myofilament bundles. The cell nucleus were big with dense nucleoli. The ultrastructure of 10-week rats was mild worse than that of 6-week rats.2. Diabetic rat's myocardial cell ultrastructure of 6 and 10 weeks:The sarcostyles were decreased, broken and fused. Disintegrated mitochondria irregularly arranged with the sarcostyles. Z line, A band, M line, and I band were vague. Number and shape of mitochondria became small with their cristae mixing together. Karyopyknosis existed and some nucleoli disappeared just like apoptosis.The damage degree of 10-week diabetic rats was more severe than that of 6-weekones.3. ROS-treated diabetic rat's myocardial cell ultrastructure of 6 and 10 weeks:The myocardial cell structure of ROS-treated diabetic rats was obviously more integrated than that of control. The myofilament bundles were well-arranged with clear Z line, A band and M band. The mitochondria with full membrane were inserted in the myofilament bundles. The Cristae could be seen, showing high cellular oxidative metabolic rate. The cell nucleus were large and nucleoli still existed. However, compared with normal structure, the myofilament bundles and mitochondria were larger and longer.Expression of ANP mRNABecause 2 rats (one in 2C and the other one in 2D) died and 4 rat samples were lost due to high liquid nitrogen freezing pressure breaking through the cover of tubes, totally 44 tissue samples were analyzed. To obtain adequate samples for comparison, male and female rats in the same treatment were combined. 6-week diabetic rats had higher ANP mRNA expression than normal control (1.0278±0.1312 ?=9 vs. 1.1384±0.0455 ?=9, P<0.05). ANP mRNA expression of 10-week diabetic rats showed no significant difference, compared with normal control. 10-week diabetic rats treated with ROS had lower ANP mRNA expression than 10-week diabetic control (1.1219±0.0884 ?=8 vs. 0.9703±0.1388 /j=9, F<0.05).Cone I us i onsHyperglycemia can cause the destruction of myocardial cell structure. ROS was able to protect diabetic rats' myocardial cell, which seems independent of glucose's control well or not. The expression of ANPmRNA is up regulated, which may be afeed-back mechanism of the myocardium so as to protect in diabetes. The down regulated expression of ANPmRNA in ROS-treated diabetes may be related with the weight gain.
Keywords/Search Tags:diabetes, ultrastructure, cardiomyopathy, atrial natriuretic peptide, peroxisome proliferator-activated receptor
Related items