Font Size: a A A

Identifiction Of Non-Candida Albicans From Vagina Of Patients With Vulvovaginal Candidasis

Posted on:2009-09-09Degree:MasterType:Thesis
Country:ChinaCandidate:Y WuFull Text:PDF
GTID:2144360245981112Subject:Dermatology and Venereology
Abstract/Summary:PDF Full Text Request
Background:Vulvovaginal candidiasis is a common vagina which is caused by various kinds of candida.In recent years,the incidence of VVC has markedly increaseed because the incdence of STDs has increased and general applying broad spectrum antibiotics,hormone,vaginal rinse and immunodepressant.The complicated etiopathogenisis and recur of VVC have to become nodus and hot spot in clinical medicine study,owning to multifarious factors in areas of pathogenic candida and organism.Association of many risk factors and morbidity of VVC are revealed that we can have the further understanding to characteristic of risk factors of VVC,and to provide evidence of prevention and cure of VVC.In spite of departed study had indicated that 85%-90%pathogenic candida of VVC was candida albican,but along with general applying of antimycotic drug,pathogenic candida and drug resistance have changed.The proportion of non-candida albicans has significantly increased especially in RVVC and drug resistance strains.To understand the characteristic of pathogenic candida and seek methods to establish more rapid,accurate diagnosis and identifiction of infected non-candida albicans in clinical laboratory.So it is necessary to research for identifiction of clinical isolated non-candida albicans.Objective:1.To analysis the predispoing factors of VVC.2.To inquire into the identifition of phenotype and genetype and the analysis of RFLP for the common pathogenic Candida species.3.To provide clinical molecule epidemiological data for isolated Candida strains from patients with vulvovaginal candidiasis,and promote the level of diagnosis,prevention and cure.Methods:From January 2007 to September 2007,A total of 200 patients with vulvovaginal candidiasis and 143 non-VVC female controls were recruited into the survey in the First Hospital of Lanzhou University,the Second Hospital of Lanzhou University and the Maternal and Child Health Hospital of Gansu provinc,then both single factors analysis and multifactor logistic regression analysis were performed with SPSS 10.0 for Windows.The vaginal secretions form patients of VVC is directly microscopic examined with 15%KOH,positive samples are cultured on Sabouraud-chloramphenicol glucose agar and incubated at 27℃.Germ tube test, chlamydospore test,CHROMagar Candida and API20 kit system were applied to separate non-Candida albicans strains from Candida albicans.The internal transcribed spacer(ITS)region of ribosomal DNA were amplified by using the fungi-universal primers ITS1(5′—TCCGTAGGTGAACCTGCGG—3′)and ITS4(5′—TCCTCCGCTTATTGATATGC—3′).Then restriction fragment length polymorphisms(RFLP)was performed by two restriction enzymes(MspⅠ,HaeⅢ) digesting those production of polymerase chain reaction(PCR)amplification.Results:1.Single factor analysis indicated that the difference of predispoing factors between VVC group and non-VVC in applying antibiotic,gestation,being accompanied by other STDs,a history of induced abortion,oral contraceptive use, wearing tight pants and favoring sweet food was compared.Multifactor logistic regression analysis revealed that gestation,being accompanied by other STDs,a history of induced abortion,oral contraceptive use,applying antibiotic,wearing tight pants and favoring sweet food were predispoing factors for vulvovaginal candidisis(OR=7.818-78.897).2.The 200 isolates consisted of 170 strains of Candida albicans(85.0%),15 strains of Candida glabrata(7.5%),7 strains of Candida parapsilosis(3.5%),5 strains of Candida krusei(2.5%),2 strains of Candida tropicalis(1.0%),one strains of Candida kefy(0.5%).3.Candida albicans,Candida parapsilosis,Candida kruse and Candida tropicalis were amplified a product size of approximately 500bp by using the fungi-universal primers ITS1 and ITS4,and Candida glabrata was amplified a product size of approximately 900bp.4.The products were digested with MspⅠand HaeⅢ,producing 4 and 2 unique band patterns,respectively.Conclusions:1.The analysis has shown that the major predisposing factors responsible for vulvovaginal candidisis are applying antibiotic,gestation,being accompanied by other STDs,a history of induced abortion,oral contraceptive use, wearing tight pants and favoring sweet food.Especially there is significant difference in gestation,being accompanied by other STDs,a history of induced abortion.2. Candida albicans is the main pathogenic yeasts and most strains of non-Candida albicans are Candida glabrata in the vulvovaginal candidiasis.3.Candida glabrata and others Candida species can be directly discriminated by using fungi-universal primers ITS1 and ITS4.It is possible to help clinic to rapid identify Candida glabrata. 4.Restriction enzymes(MspⅠ,HaeⅢ)may technically identify the common pathogenic non-Candida albicans.
Keywords/Search Tags:Candidisis,vulvovaginal, Predisposing factors, non-Candida albicans, Polymorphism restriction fragment length
PDF Full Text Request
Related items