Objective and significanceTo clone the gene of methyl-accepting chemotaxis signal transduction protein of Helicobacter hepaticus,make the recombinant protein as antigen,the ELISA detection kit was made to detect the serum specific immune globulin(Ig) of the people who had infected with Helicobacter hepaticus.It was possible to detect the people's infection rate of Helicobacter hepaticus in our country and approach the etiopathogenisis of liver diseases and intestinal non-specificity inflammation of human.Materials and methods1,Main materials:Helicobacter hepaticus strain,prokaryotic expression plasmid pET22b(+),Anti-His monoclonal antibody(MA),Campylobacter jejuni selective blood agar medium,Ni-NTA affinity column,goat anti-mouse IgG labelled by horse radish peroxidase(HRP),goat anti-human IgG labelled by HRP.2,Methods2.1 Primer designConservation gene fragment MCP(255bp) of Helicobacter hepaticus HH1088 was selected from GenBank.The primers designed by Primer Premier 5.0 were sense 5'GACGAATTCCGTAGAGCAAGGGGATTTC 3' and antisense 5'CGCCTCGAGT CTTTGTTTGAGCATTTT 3'.The sense and antisense primers contained the cutting sites of EcoRI and XhoI restriction endonuclease respectively.2.2 Construction of prokaryotic expression plasmid pET22b+/MCP 100μl Helicobacter hepacticus was spreaded to Campylobacter jejuni(C.jejuni) selectivity blood agar medium which contained 7%freeze thawing dis-fibrilla sheep blood,1%selective antibiotic including vancomycin 10mg/L,Polymyxin B 2500U/L, Amphotercin B 10mg/L and TMP 5mg/L.It was cultivated in the condition of 37℃microaerobion(5%O2.10%CO2 and 85%N2) and observed everyday.The colony which was transparent and needle tip-like was scraped into the EP tube with cotton bud,then washed three times with PBS.The genome DNA of Helicobacter hepaticus was extracted using bacteria genome DNA extracting kit.With the genome DNA of Helicobacter hepaticus as template,the gene was amplified by PCR.The PCR conditions were initial denaturation at 94℃for 30min,followed by denaturation at 94℃for 30sec,annealing at 50℃for 30sec,and extension at 72℃for 45s for 35 cycles,with the final extension at 72℃for 10min after the last cycle of amplification. The DNA generated by PCR was cut with EcoRI and XhoI,and ligated into prokaryotic expression vector pET22b(+) at the same cutting sites.The reconstructed plasmid was called pET22b+/MCP.After transformed into E.coli and amplified,the reconstructed plasmid was identified by double cutting with EcoRI and XhoI and gene sequencing.2.3 Expression of recombinant MCP protein in E.coliThe pET22b+/MCP plasmid was transformed into E.coli BL21(DE3) and plated on LB agar medium containing ampicillin(100μg/ml).Mono-colony was cultivated in 10ml LB medium at 37℃,200rpm for half and three hours until that OD600 of culture solution was between 0.6 and 1.0,then 100μl culture solution was continued to cultivate in 10ml LB medium at 37℃,200rpm for half and one hours until OD600 was 0.6 approximately.500mmol/L IPTG was added into the culture solution which was continued to culture at 37℃,200rpm for four hours.The induced solution was centrifuged at 4℃,12000rpm for five minutes,then identified by SDS-PAGE and Western blot.2.4 Purification of recombinant MCP protein1000ml induced solution was centrifuged at 4℃,12000rpm for five minutes,in which bacteria lysate and PMSF was added subsequently.After crushed by sonicator on the ice and centrifuged at 4℃for fifteen minutes,the supernatant of solution was abandoned.The sedimentum was put at room temperature for thirty minutes after added bacteria lysate and PMSF again,then centrifuged at 4℃for fifteen minutes. The supernatant was put in the chromatography,and eluted by UrNTA-20, UrNTA-40,UrNTA-60,UrNTA-100,UrNTA-200,UrNTA-500 respectively.The target protein of eluted solution was definited by SDS-PAGE.The eluted solution was dialysed by gradient Urea-PBS.After measured protein concentration,the purified protein was stored at -70℃.2.5 Serology analysis of H.hepaticus infection in miceTwenty-one athymic mice containing nine suckling mice and thirty-two NIH mice containing twenty-four gnotobiotic mice were bought from animal center of southern medical university.With the genome DNA of colon tissue as template and C255F/C255R as specific primer,the specific product was amplified by PCR,then identified by 1.5%agarose gel electrophoresis and gene sequencing.The other aspect, the serum got from heart or arteria carotis of mouse was used for ELISA.After determining the best coating concentration and best sample dilution by Checkerboard titration,the board was coated with 5μg/ml purified protein rhMCP at 4℃overnight. Then the mouse serum,HRP goat anti-mouse IgG and substrate OPD were added sequencially next day.The OD value of mixture was determined by double wave length after terminating reaction.2.6 Cutoff value assessment of ELISA method of H.hepaticus infection in human Both feces samples and sera samples from 59 patients who had been definited in digestive department of NanFang Hospital during December 2008 to March 2009 were selected,including 6 posthepatitic cirrhosis patients,2 liver cancer patients,10 colon cancer patients,4 Crohn's disease patients,6 ulcerative colitis patients,9 duodenal ulcer patients,6 simple gastritis patients,5 gastric cancer patients,9 people as normal control.With the genome DNA of feces tissue as template and C255F/C255R as specific primer,the specific product was amplified by PCR,then identified by 1.5%agarose gel electrophoresis and gene sequencing.The serum samples were used for ELISA analysis and the cutoff value was determined in consideration of feces PCR results.2.7 Initial approach of H.hepaticus infection in human by ELISA methodSera samples from 233 patients who had been definited in digestive department of NanFang Hospital during November 2007 to March 2009 were selected,including 33 posthepatitic cirrhosis patients,29 liver cancer patients,26 colon cancer patients, 15 Crohn's disease patients,21 ulcerative colitis patients,8 enteronitis patients,23 polyp intestinal patients,2 intestinal tuberculosis patients,16 duodenal ulcer patients, 23 simple gastritis patients,18 gastric cancer patients,5 other cancer patients,13 people as normal control.The sera samples were used for ELISA analysis and were assessed by determined cutoff value.Results1.Construction of prokaryotic expression plasmid pET22b+/MCPWith genome DNA of H.hepaticus as template,255bp MCP gene fragment was amplified by PCR.After the fragment was cloned to prokaryotic expression vector, the sequencing results was conformity with the gene sequence of H.hepaticus type strain ATCC51449 published by GenBank.It was successful to construct prokaryotic expression plasmid pET22b+/MCP.2.Expression of recombinant MCP protein in E.coliRecombinant protein rhMCP of which the relative molecular mass was 14118D was expressed from E.coli BL21(DE3) containing recombinant plasmid after IPTG inducing,it was mainly in the sediment through SDS-PAGE identification,so the existence pattern of rhMCP was non-solubility cytorrhyctes.There was one specific strap of which the position was about 14KD by Western blot identification.3.Purification of recombinant MCP proteinrhMCP induced by IPTG was dissolved by 8M urea because its existing form was insoluble inclusion bodies and eluted by gradient urea-PBS according to purification method of degenerated protein.The best elution liquid was UrNTA200. The soluble rhMCP was acquired by dialysis with gradient urea-PBS after purification.The protein concentration of rhMCP was 0.73mg/ml by BCA.4.Serology analysis of H.hepaticus infection in miceThe amounts of positive and negative samples were 22 and 31 cases respectively after amplification by specific primer C255F/C255R of H.hepaticus.With the mean of OD492 value of negative samples plus 2 times standard error(M+2SE) as ELISA cutoff value,the cutoff value was 0.390,sensitivity was 72.7%,specificity was 77.4%. There was not significant difference between ELISA method and PCR method(P=1.000,P>0.05<two-sided>),and there was statistical significance in the goodness of fit between the two detective methods but in general(κ=0.498,P=0.000).5.Cutoff value assessment of ELISA method of H.hepaticus infection in humanThe amounts of positive and negative samples were 27 and 32 cases respectively after amplification from feces genome DNA by specific primer C255F/C255R of H.hepaticus.There were 2 positive cases which were identified by sequencing further and 7 negative cases in normal control group.There was 99%identity between the sequencing results and MCP gene published by GenBank.With the mean of OD492 value of 7 negative samples in normal control group plus 2 times standard error (M+2SE) as ELISA cutoff value,the cutoff value was 1.081,sensitivity was 77.8%, specificity was 71.9%.There was not significant difference between ELISA method and PCR method(P=0.607,P>0.05<two-sided>),and there was statistical significance in the goodness of fit between the two detective methods but in general(κ=0.492, P=0.000).6.Initial approach of H.hepaticus infection in human by ELISA methodIt could been seen that there was a higher positive rate of patients who suffered from liver or intestinal diseases,after 233 sera samples collected had been detected by ELISA.The positive rate of liver diseases group,colon cancer group,intestinal ulcer diseases group,intestinal infectious and hyperplastic diseases group,duodenal ulcer group,stomach diseases group,other tumor group were 74.2%,63.0%,66.7%, 57.6%,37.5%,39.0%and 20.0%respectively.There was significant difference in positive rate of H.hepaticus during these diseases groups(χ2=23.587,P=0.001, P<0.05).As can been seen from above data,there was a higher positive rate of the diseases of which the site were possible colonization sites of H.hepaticus by ELISA.ConclusionProtokaryotic expression plasmid pET22b+/MCP was constructed successfully by molecular cloning technique in this research.The recombinant protein rhMCP was expressed by IPTG inducing and purified by affinity chromatography system.With rhMCP as detective antigen,Specific immune globulin of human sera was detected by ELISA.While feces PCR technique as golden standard,the cutoff value of ELISA was determined initially.It could be found that the H.hepaticus positive detection rate in diseases,the sites of which were also planting sites of H.hepaticus,was higher.It was possible to investigate the infection rate of H.hepaticus and approach the etiopathogenisis of liver diseases and intestinal non-specific inflammary in our country.
|