Sp1 Regulates FHL2 Expression By Transcriptional Regulation

BACKGROUD AND OBJECTIVESAs a novel-identified oncogene,FHL2(Four and a half LIM Protein 2) plays important role in the devolpment of gastrointestinal(GI) cancers.It is known that FHL2 being able to modulate the function and/or expression of numerous downstream genes,however,the regulation of FHL2 has been seldomly investigated. By bioinformatical analysis,several putative Sp1(Specificity protein 1) binding elements were found within the 5'-flanking region of FHL2,the purpose of this project is to clarify the effect of Sp1 on transcription regulation of FHL2 gene.METHODS1.Cells and cell cultureGI cancer cell line,Kato-â…¢,SW480 and LoVo were maintained in 1640(Gibco) supplemented with 10%FBS,100U/ml penicillin.The cells were incubated in a humidified incubator at 37℃with an atmosphere of 5%CO₂.2.Generation of FHL2 promoter-luciferase constructs.The genomic DNA was obtained from the SW480.The four insert DNA fragments of the 5-flanking region of the FHL2 gene were amplified by a PCR method using specific primers.The synthetic linkers and restrition sites for both KpnI (GAGGTACC) and NheI(GAGCTAGC) are indicated below.The PCR was performed as follows:95℃for 30min and then 36 cycles of 94℃for 30s(for denaturation),For 55℃for 45s(for annealing),and 72℃for 1min(extension).After the final cycle,an elongation step was carried out at 72℃for 10min.The amplified DNA products were gel-purified using a gel extraction kit(Gel DNA Recovery kit; AXYGEN,USA).For the luciferase reporter gene assays,DNA fragments containing restriction site adapters were digested with either KpnI forward or NheI reverse.The digested DNA fragments were cloned into a firefly luciferase expression vector, pGL3-Basic vector(Promega) which had already been digested with the enzymes KpnI and NheI.The activity of the promoterless vector,pGL3-Basic,which contained no insert,was measured to determine background activity.Each plasmid construct was subcloned into TOP10 bacterial cells,and the plasmids were subsequently isolated and purified.The entire DNA sequences of the cloned fragments were confirmed with gene sequencing.3.Transient Transfection and Luciferase AssaysFor the luciferase assay,cells were plated at a density of approximately 2×10⁴ cells in twenty-four wells plate until 70%confluent growth was reached.On the next day,growth medium was removed from cells before transfection.A transfection complex was prepared by mixing 0.8μg of the indicated pGL3-luciferase constructs and 0.008μg pRL-CMV with lipofetamine 2000.Transient transfection was performed according to the instruction of lipofetamine 2000(Invitrogen).Two days later,the cells were harvested;dual-luciferase assay was performed to measure the luciferase activities using a luminometer(Aureon Biosystems) according to the manufacturer's protocol(Promega).Promoter activity was presented as the fold induction of relative luciferase unit(RLU) compared with the basic vector control. RLU= value of firefly luciferase unit/value of renilla luciferase unit.All treatments were triplicated for each single experiment.4.ImmunohistochemistryImmunohistochemistry was performed to detect Sp1 and FHL2 in situ,antigen retrieval and an indirect immunoperoxidase technique were applied as reported before. The mouse anti-Sp1 monoclonal antibody(dilution 1:200),the rabbit anti-FHL2 polyclonal antibody(dilution 1:300) and the biotin-linked antimouse IgG(Dako, Copenhagen,Denmark) in combination with the ABC complex were used.Normal IgG(Sigma) was used as the isotype controls. 5.Preparation of Cytoplasmic and Nuclear Extract and Western blottingThe cells were resuspended in 400μl of buffer A(containing 10mM Hepes at pH 7.9,1.5mM MgCl₂,10mM KC1,0.5mM DTT,0.5mM PMSF,1μg/ml leupeptin, 1μg/ml aprotinin,and 1μg/ml pepstatin A),lysed with 12.5μl of 10%Nonide P-40, and centrifuged at 12,000g for 10min at 4℃.The supematant was collected and used as the cytoplasmic extracts.The nuclei pellet was re-suspended in 4.0μl of buffer B (20mM Hepes,pH 7.9,containing 1.5mM MgCl₂,450mM NaCl,25%glycerol,0.2 mM EDTA,0.5mM DTT,0.5mM PMSF,1μg/ml leupeptin,1μg/ml aprotinin,1μg/ml pepstatin A),agitated for 60min at 4℃,and the nuclear debris was spun down at 20,000g for 15min.The supernatant(nuclear extract) was collected and stored at-70℃until ready for analysis.Protein concentrations were determined with BCA Protein Assay Kit.6.Electrophoretic Mobility Shift AssayDouble-strand FHL2 gene specific DNA probes that contained the specific Sp1 binding elements were synthesized.The sequences of sense strands were as follows: (-485)5'- AGAGGGCCCGGGCTTGGAATGT -3'(-464) and(-123) 5'-TGCCAC CGCGCCCAGGCCTCGT -3'(-102).After annealing,double-strand DNA probes were end labeled with 5μCi ofγ-³²P -ATP(PerkinElmer Life and Analytical Sciences) using T4 polynucleotide kinase(Promega).For electrophoretic mobility shift assay (EMSA),total reaction mixtures containing 10mmol/L Tris/HCl(pH 7.5),1 mmol/L MgCl₂,0.5mmol/L dithiothreitol,0.5mmol/L ethylenediaminetetraacetic acid, 50mmol/L NaCl,4%glycerol,and 0.5μg of poly(dI-dC)-poly(dI-C)/mL,were incubated with 2μg of nuclear extracts and various unlabeled competing oligonucleotides for 10 minutes at room temperature,followed by addition of 1μl ([0.5-2]×10⁵ counts per minute) of the various ³²P-end-labeled oligonucleotides. Samples were separated by electrophoresis on 5%nondenaturing polyacrylamide gel, with detection of radioactive bands by autoradiography for 12-16 hours at -70℃.The mutation sequence of the probe was(-485) 5'- AGAGGACCAGGTCTTGGAATGT -3'(-464).7.siRNA Transfection The siRNA duplexes consisted of 21 bp oligonucleotides and the sequence of the Sp1-siRNA was as follows:AAAGCGCUUCAUGAGGAGUGA.The GL2 siRNA (UUCUCCGAACGUGUCACGUTT) was used as the negative control.The cells were transfected with siRNA duplexes using LipofectAMINE2000 reagent (Invitrogen) according to the manufacturer's instructions.8.Reverse-Transcription Polymerase Chain ReactionRNA was reverse-transcribed to complementary DNA(cDNA) by Thermoscript reverse-transcription polymerase chain reaction(PCR) system(Invitrogen) in accordance with the manufacturer's instructions.PCR was performed using 2μl of resulting cDNA,0.125μl of Hotstart DNA polymerase(Qiagen,Hilden, Germany),forward and reverse primers,and deoxynucleoside triphosphates in a final volume of 25μl.The sequences of the primers were as follows:FHL2 forward:5'-AGAGTTTCATCCCCAAAGACAA -3';FHL2 reverse:5'- AGTTCAGGCAGTA GGCAAAGTC-3';Sp1 forword:5'-CGCTCCCAACTTACAGAA-3';reverse:5'-GCTATTGGCATTGGTGAA -3'.Hotstart PCR was performed for 32 cycles with 95℃denaturation for 30 minutes(first cycle),94℃denaturation for 30 seconds, 53°℃annealing for 30 seconds,and 72℃elongation for 60 seconds and 10 minutes (final cycle).The amplification product was of the expected sizes.9.ImmunoblottingCell lysates(30μg) were electrophoresed on denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel(5%stacking gel and 10%separating gel).Proteins were transferred to polyvinylidene difluoride membranes(Perkin Elmer, Fremont,CA).Nonspecific binding was blocked with 10 mmol/L pH 7.6 Tris-HCl buffer saline plus 0.05%Tween-20 containing 5%skim milk.The blots were probed with primary anti-human FHL2 antibody followed by the HRP-conjugated anti-rabbit second antibody.Antigen-antibody complexes were visualized by the enhanced chemiluminescence(ECL) system(PIERCE).10.Site-Directed Mutagenesis AnalysisThe QuikChange Site-Directed Mutagenesis Kit(Stratagene,La Jolla,CA) was used to generate constructs with the mutation of the putative interferon regulatory element(GC box-FHL2).The primers of mutation were as follows:wild-type sequence:agcgtcacgcagagggcccgggcttggaatgtgggagg;mutation sequence:agcgtcacg cagaggaccaggtcttggaatgtgggagg.Briefly,pLuc-595 construct was PCR-amplified in the elongation process using Pfu DNA polymerase with the earlier-described double-strand primers.The incorporation of oligonucleotide primers generates a mutated plasmid containing staggered nicks.The product then is treated with DpnI endonuclease,specific for methylated and hemimethylated DNA,enabling the parental DNA template to be digested(because DNA originating from Escherichia coli usually is dam methylated).The nicked vector DNA carrying the desired mutations was proliferated in Epicurian coli XL1-Blue supercompetent cells.Plasmid DNA was isolated and sequenced to verify the prospected mutated sequence.The mutation plasmid was transfected transiently into cancer cells to Luciferase assay.11.Statistical AnalysisThe data of Luciferase assay,RT-PCR and Western Blotting were expressed as the mean of three independent expression±S.D,evaluated with t-test or one-way ANOVA.Mann-Whitney Test was used to assess the differences of staining intensity. Correlation analyses for quantification of FHL2 and Sp1 positive staining were performed using Spearman Correlation.P＜0.05 was defined as different signicantly. All of these analyses were made using SPSS Version 13(SPSS,Chicago,IL,USA).RESULTS1.Positive correlation between Sp1 and FHL2 in colon cancerTo detect Sp1 and FHL2 expression in situ,we collected matched cancer and noncancerous colon tissues under colonoscopy.As determined by IHC,specific nuclear Sp1 protein was high expressed in the carcinoma cells.FHL2 positive signal presented in both the cytoplasm and nucleus of cancer cells but not in the normal colon epithelial cells.These findings demonstrated that Sp1 expression correlated with FHL2 in colon cancer cells.2.Location of the regulatory promoter of FHL2 geneTo locate the regulatory promoter of FHL2,we used DBTSS software to analyze the promoter seqeunce of FHL2.TF search was applied to find the transcription factor binding site.Several typical and nontypical GC-box were found in the promoter of FHL2 and four different length of gene seqeunces were cloned to investigate the transcription activity of the promoter.Truncated 5'-flanking seqeunces extending up to-997nt of FHL2 gene were inserted in forward orientation upstream of a luciferase reproter gene(pGL3-Basic vector) to generate pLuc constructs pLuc-1008(-997 nt～+10 nt),pLuc881(-870 nt～+10 nt),pLuc595(-584 nt～+10 nt) and pLuc382(-371 nt～+10 nt),the first nucleotide adjacent to the transcription starting site was here difined as 0.Dual luciferase assay revealed that the highest RLU was observed for pLuc-595 in all three cells tested,indicating the presence of cis-enhancing element(s) between -584 to -371nt.However,transfection of the longer FHL2 5'-flanking sequences,pLuc-1008,resulted in a significant decrease in transcription activity,thus implicating the presence of a potential repressor element(s) between -997 and -584nt. All cell lines had a similar pattern of transcription activities with different values for individual constructs.3.Identification of Sp1-binding sequence in FHL2 promoterThe consensus Sp1 binding sequences comprises GC-rich elements arranged as 5'-(G/T)GGGCGG(G/A)(G/A)(C/T)-3'.Two typical binding elements that located at -485nt to -464nt and -123nt to -102nt were identified within FHL2 5'- flanking region.To test the binding capacity of these sequences,EMSA was performed using the following two-step strategies.First,the capacity of a 50-fold excess of unlabeled oligonucleotides(-485/-464 and -123/-102) was used to compete and block binding to radioactively labeled probes.We found that -485/-464nt but not -123/-102nt oligonucleotide gave rise to specific binding while could be completely blocked by the cold probe.Secondly,a mutated probe with the mutation of Sp1 binding sequence was applied to verify the binding specificity of-485/-464nt probes.We found the site-mutation of Sp1 binding sequence abrogated the binding capacity completely. Therefore,we concluded that a high affinity Sp1 binding element existed in the -485/-464 region of FHL2 gene.4.Down-regulation of FHL2 transcription activity by inactivation of Sp1 binding activity To inactivate the binding of Sp1,we had synthesized a Sp1-siRNA to inhibit Sp1 expression.Moreover,mithramycin A(MIT),a novel defined Sp1 inhibitor,was applied to examine its effect on the transcription activity of truncated FHL2 promoter constructs.Kato-â…¢,SW480 and LoVo cells were transiently transfected with pLuc-1008,pLuc-881,pLuc-595 and pLuc-382 followed by incubation with control siRNA,Sp1-siRNA or MIT.Cells were lysed and assayed for luciferase activity. Dual luciferase assay showed that Sp1-siRNA and MIT significantly decreased the transcription activity of all constructs,suggesting that Sp1 was essence for FHL2 transcription.In addition,we introduced the gggcccggg to ggAccAggT mutation into pLuc-595 to abrogate Sp1-specific binding activity.We found that the RLU induction of wild type and mutant pLuc-595 constructs were 11.90±1.99 and 4.11±0.86 in Kato-â…¢cell;7.02±0.03 and 2.31±0.18 in SW480 cells and 7.72±1.17 and 1.65±0.47 in LoVo cells,respectively.Mutation of Sp1 binding sequence decreased the transcription activity of pLuc-595 significantly(P＜0.05 compared with the wild type control).5.Reduced FHL2 expression by inhibiting Sp1 expresionAt last,we evaluated FHL2 expression in presence or absence of Sp1 suppression by RT-PCR and Western blotting.We found that both Sp1-siRNA and MIT suppressed FHL2 expression.CONCLUSIONS1.Sp1 and FHL2 expression were positively correlated in colon cancers with both expressions were upregulated in cancer cells when comparing to normal tissues.2.Within the 1000bp 5'-fianking region of FHL2 gene,the fragment between -584nt to -371nt possessed high level of transcription activity.3.A functional Sp1 regulatory element with high affinity was identified at -485nt to -464nt upstream of the transcription starting site that mediated the positive regulation of FHL2 transcription.