Gene Cloning, Prokaryotic Expression And Functional Evaluation Of Intimin From Enterohemorrhagic Escherichia Coli O157:H7

1.Background and ObjectiveEnterohemorrhagic Escherichia coli(EHEC)O157:H7 is newly found pathogen which can cause severe hemorrhagic colitis(HC),thrombotic thrombocytopenic purpura(TTP) and hemolyticuremic syndrome(HUS) in human.EHEC O157:H7 can attach firmly to host cell membrane and remove microvilli and cytoplasm forming an attaching-and-effacing(A/E) lesion.EHEC O157:H7 intimin is an outer membrane protein encoded by the eae gene of EHEC O157:H7.Intimin is exported via the general secretory pathway to the periplasm,where it is inserted into the outer membrane by a putative auto transport mechanism.Intimin has two functional regions:the N-terminal region,highly conserved between different EPEC and EHEC strains,which is inserted into the bacterial outer membrane,forming a barrel-like structure,mediating dimerization.The C-terminal 280-amino acid sequence of intimin(IntC280) is variable,defining several intimin types,which extends from the bacterium,and interacts with receptors in the host cell plasma membrane.EHEC O157:H7 intimin is intimin-γand is composed of 934 amino acids. The cell binding activity of intimin has been localized to its C-terminal 280 residues.Treatment of infection with E.coli O157:H7 has been difficult because antibiotics do not change the course of the enteritis of E.coli O157:H7 and may increase the incidence of HUS.This untoward effect has been presumed to be mediated by antibiotic-induced bacteriolysis releasing of intracellular Shiga toxins.Since EHEC O157:H7 vaccine has not been invented.Revealing the pathogenic mechanism of EHEC O157:H7 and the interaction between intimin and its receptors would be of great benefit to counter bioterrorism and help preventing the spread of the disease in children and the elderly.This study attempted to clone eae gene,purificate intimin protein and detect its immunoreactivity by Western blot.The purified intimin was detected by immunofluorescence staining to test its adhesion and whether intmin has the eukaryotic receptors or not.2.Methods(1) Gene cloning,expression and purification of recombinant intmin from EHEC O157:H7.PCR primers were 5'GGTGGTCA TATGATTACTCATGGTTGTT AT3' upstream and 5'CCGTC TCGAGTTCTACACAAACCGCATAG3' downstream, which were added restriction enzymes Ndel and Xhol respectively.The primers were designed and synthesized to amplify the intimin coding gene eae by PCR,and then the PCR product was cloned into pMD19-T vector.Thereafter,the plasmid pMD 19-T-eae was digested with the restriction enzymes ScaI,NdeI and XhoI.And the eae gene was ligated into vector pET-28a(+)—cut with the restriction enzymes NdeI and XhoI to yield plasmid pET-28a(+)-eae.Then the recombinant prokaryotic expression plasmid pET-28a(+)-eae was transformed into E.coli BL21(DE3) and the target protein induced by IPTG was detected by 10%SDS-PAGE.The form of protein intimin expression was identificated by Ultrasound.The recombinant protein intimin was purified with Ni²⁺-chelating affinity chromatography followed by identification with 10%SDS-PAGE.(2) The functional evaluation of recombinant protein intimin.The immnoreactivity of intimin was detected by Western blot as follows:Purified intimin was detected with primary rabbit anti- EHEC O157:H7 serum followed with secondary goat anti-rabbit-IgG serum conjugated to HRP.The purified intimin was detected by immunofluorescence staining to test its adhesion as follows:Subconfluent HEp-2 cells were seeded into 6-well chamber coverslips at a density of 6×10⁴ cells/well and incubated for 24h;Purified samples of histidine-tagged intimin were diluted into protein binding buffer to a final concentration of 5,10,20μg/ml respectively.HEp-2 cell monolayers were incubated with the protein samples for 1 h at 37℃,bound intimin was detecter with monoclonal antibody against the 6-histidine tag and followed with secondary goat anti-mouse-IgG serum labeled with IgG-Alexa Fluor 546.3.Results(1) Gene cloning,expression and purification of recombinant intmin from EHEC O157:H7.The 2805bp eae gene fragment was obtained,the sequence homology of PCR product was 99%blasted with the eae gene sequence(accession number:z11541 ).Nine bases had changed and the sites were 208,670,731,942,945,961,1352,1935,2392 respectively,three sites amino acids had changed correspondingly.The recombinant protein intimin was successfully expressed in E. coli BL21(DE3).The molecular weight of the recombinant protein was 97kDa, which was dected by 10%SDS-PAGE.Optimized intimin expression condition,we think that the optimal expression condition of intimin was that E.coli BL21(DE3) was inducted by 1mM IPTG for 4h at 37℃.The form of protein intimin expression was inclusion body which was identificated by Ultrasound.Purification of intimin by nickel-affinity chromatography was accomplished by changing the concentration of imidazole.At last,we detected the concentration of purified intimin was 1mg/ml.(2) The functional evaluation of recombinant protein intimin. Immunoreactivity of intimin was detected by Western blot,which was recognized by rabbit anti-O157 antiserum,the molecular weight of the recombinant protein was 97 kDa.The result was consistent with the expect.The experiment of intimin binding to...