North To Spend The Loach Mitochondrial Genome Sequencing, And Loach Phylogenetic Analysis

The complete sequence of Cobitis granoei mitochondrial genome was determined by using long accurate PCR and sub-PCR and analyzed using some bioinformatics software. In the study, parts of Loach mitochondrial genes, which were published in Genbank, were used to infer the phylogeny of Loach. There are the Conclusions:1. The length of Cobitis granoei mt genome is 16578 bp, which contains two rRNA genes (12SrRNA and 16SrRNA),thirteen protein genes (COâ… ,COâ…¡,COâ…¢,ATP6,ATP8,ND1,ND2,ND3,ND4,ND4L,ND5,ND6,Cyt b),twenty-two tRNA genes and one D-loop control region.2.There is some AT deflection in the Cobitis granoei mt genome nucleotide. The Cobitis granoei's A+T content is 55.8%.The A+T content of Cobitis granoei's D-loop control region is 64.5%, which is much higher than the Cobitis granoei's complete sequence's total level.3.Except COâ… gene using special initiation codon GTG, the rest protein genes of Cobitis granoei are the typical initiation codon ATG. The temination codon of ND1,ATP8, COI, ATP6,ND4L and ND5 are the complete TAA.The temination codon of ND3 and ND4 are TA.The temination codon of COâ…¡, COâ…¢,Cytb, ND2 and ND6 are T.4.The complete secondary structure of 12SrRNA and 16SrRNA genes in Cobitis granoei mitogenome were predicted. Both of secondary structures are conservative. Compared with the published secondary structure, the 12SrRNA of Cobitis granoei also contains forty-three stem-loops'structure and the secondary structure of 16SrRNA contains six domains and fifty-three stem-loops'structure.5. All of Cobitis granoei tRNA genes have a typical clover leaf structure except the tRNA-SerAGY. The DHU arm of tRNA-SerAGY is a loop.Some unmatched base pairs in the Cobitis granoei tRNAs can be found, most of which are G-U pairs.6. Between tRNAPro and tRNAPhe is the D-loop control region, which is a conserved position. The length of Cobitis granoe's D-loop control region is 922 bp, the content of A+T is 64.5%.In this study, we found the terminal associated sequences named TAS, central conserved sequence blocks and conserved sequence blocks in the D-loop control region of Cobitis granoei. The situations are TAS(TACATATTA), CSB-D(TATTACTGGCATCTGTGTA),CSB-F(ATGTAGTAAGAGACCA),CSB-E(T CAGGGACAATAATCGTGGGGGT),CSB-1(AGTTAATGTGAATGAATGATGAA AAGA),CSB-2(CAAACCCCCTTACCCCC),CSB-3(TGTCA AACCCGAAACCA).7.From the phylogenetic analysis, which were based on the 3 sets of data, we can conclude that:1) Cobitinae, Noemacheilinae and Botiinae should be Cobitidae, Nemacheilidae and Botiidae.2)The phylogenetic relationships among Loach is Botiidaeâ†'Nemacheilidaeâ†'Cobitidae. Among all of them, Nomacheilidae and Cobitidae have more closely relationships.3) Vaillantellinae should belong to Botiidae.8.The mitogenome data is proved to be aneffective way in biological systemmatics and phylogeny reconstruction.