ObjectiveCancer treatment is the challenge that clinicians have to face.Because of tumor metastasis,traditional treatments,such as operation,chemotherapy or radiotherapy, perform limited effects on cancer treatment.Therefore,new treatments that have better selectivity towards tumor cells is necessary.And the new treatments will not be antagonistic to commonly used methods.Replication-selective oncolytic Adenovirus(RSOA) is a new method which posesses broad foreground in tumor-treatment field.Combined with chemotherapy and radiotherapy ,it displays evident security and validity.But using RSOA alone shows little anti-tumor effects.The specific change of gene in tumor cells is the key factor impacting the anti-tumor effects by RSOA.And the signal pathway which includes the specific gene and have close relationship with adenovirus is another key facor.DARPP-32 is such a gene that show different expression between tumor cells that sensitive to virus-killing and tumor cells not.DARPP-32(Dopamine and cAMP-regulated phosphoprotein) is a phosphoprotein which is regulated by dopamine and cAMP.It lies at 17q12. DARPP-32 has two different products: DARPP-32(32KD) and t-DARPP(30KD).They are both in cytoplasm and belong to phosphatase inhibitor1 family.DARPP-32 is a phosphoprotein regarded as an essential mediator of the biological effects of dopamine, which plays a central role in the neurobiology of slow synaptic transmission. DARPP-32 is also the only known bifunctional protein that can acts as a PP1 inhibitor or a PKA inhibitor. It orchestrates the degree of phosphorylation in a variety of molecular targets in the cell membrane and cytoplasm.Recent studies have demonstrated that DARPP-32 and t-DARPP were overexpressed in gastric cancer, which suggested that DARPP-32 may be involved in the signaling pathways that are important for tumorgenesis, but the mechanism remains obscure.One aim of this study is to check the expresssion of DARPP-32 gene in human pancreatic cancer.The other is to find out whether t-DARPP protein impact the anti-tumor effect by Replication oncolytic Adenovirus through plasmid DNA transfection, Western blot and virus killing test.Methods1. Immunohistochemical test: Oberserve the expression of DARPP-32 in pancreatic cancer.2. Identification of pcDNA3.1 (+) -t-DARPP: they were cut by HindIII and EcoR I . At the same time, sequence identification was performed.The length of t-DARPP gene was 525bp.3. Transfection with Lipofectamine 2000: Transfect pcDNA3.1 ( +) -t-DARPP to PaTu8988T pancreatic cell lines which do not express t-DARPP in order to express t-DARPP.4. RT-PCR was performed to check the transfection.The primers of t-DARPP:5' TGCGCTGGCTCAGTCTCCTT 3'5' GGCCTGGTTCTCATTCAAATTGCT 3'5. Western blot of protein derived from PaTu8988T lines is used to test whether the transfection is successful.6. Virus tumor-killing test with CCK-8: It is performed to decide whether t-DARPP protein take on anti-turner effect by Replication oncolytic Adenovirus to the cell lines including t-DARPP and the cell lines not.The datas were analyzed by One Way ANOVA,paired t-test and so on.SPSS13.0 was used.Results 1. Immunohistochemical test:According to positive area and shade of the slice,30% of the slices were positive.2. t-DARPP is inserted into pcDNA3.1 (+) correctly.3. RT-PCR result shows the transfection is successful.4. Western blot result shows that after transfection to PaTu8988T which transfected with pcDNA3.1 (+) -t-DARPP begins to express t-DARPP.5. The result of virus tumor-killing test shows t-DARPP protein can improve the PaTu8988T's sensibility to virus tumor-killing.Conclusions1. DARPP-32 is expressed in 30% of humam pancreatic cancers.2. t-DARPP protein can improve the PaTu8988T's sensibility to virus tumor-killing. |